Skip to main content

Advertisement

Table 2 Sequences of primers and probes used in the quantitative PCR assays

From: Subgingival periodontal pathogens associated with chronic periodontitis in Yemenis

Test species Sequences 5′-3′ Target gene Product size Ref
A. actinomycetemcomitans F-primer: GGRAGAATGGATGGCGATAT hgpA 81 bp This study
R-primer: ATCAGAATGAACATAACCTATACCA
Probe: FAM- ATGAACGCAATTCAGCCCAGA ACTG-BHQ
P. micra F-primer: TGAGCAACCTACCTTACACAG 16S rRNA 112 bp [17]
R-primer: GCCCTTCTTACACCGATAAATC
Probe: FAM- ACCGCATGAGACCACAGAA TCGCA-BHQ
P. gingivalis F-primer: ACGAATCAAAGGTGGCTAAGTT fimA 85 bp [17]
R-primer: TTAGTCGCATTTTCGGCTGAT
Probe: FAM- CCTGCTGTTCTCCATTATAAAC CATTACGG -BHQ
T. forsythia F-primer: GATAGGCTTAACACATGCAAGTC 16S rRNA 99 bp [17]
R-primer: GTTGCGGGCAGGTTACATAC
Probe: FAM- TTACTCACCCGTGCGCCGGTCG-BHQ
T. denticola F-primer: GGGCGGCTTGAAATAATRATG 16S rRNA 92 bp [17]
R-primer: CTCCCTTACCGTTCGACTTG
Probe: FAM- CAGCGTTCGTTCTGAGCCA GGATCA-BHQ
Total bacteria F-primer: AAACTCAAAGGAATTGACGGGG 16S rRNA 205 bp [17]
R-primer: TTGCGCTCGTTGCGGGACT
Probe: FAM-CTGTCGTCAGCTCGTGTCGTGA-BHQ
Fusobacterium spp.* F-primer: CGCAGAAGGTGAAAGTCCTGTAT 23S r RNA 101 bp [18]
R-primer: TGGTCCTCACTGATTCACACAGA
Probe: FAM- CTTTGCTCCCAAGTAACATG GAACACGA-BHQ
Prevotella spp.* F-primer: ACCAGCCAAGTAGCGTGCA 16S rRNA 153 bp [19]
R-primer: TGGACCTTCCGTATTACCGC
  Probe: FAM- AATAAGGACCGGCTAATTCC GTGCCAG -BHQ    
  1. *Species coverage is provided in the original reports.