Skip to main content

Table 1 List of primer sequences for real-time PCR

From: Effects of platelet rich plasma (PRP) on human gingival fibroblast, osteoblast and periodontal ligament cell behaviour

Gene Primer Sequence
hTGF-β F actactacgccaaggaggtcac
hTGF-β R tgcttgaacttgtcatagatttcg
hPDGF-A F cacacctcctcgctgtagtattta
hPDGF-A R gttatcggtgtaaatgtcatccaa
hPDGF-B F tcccgaggagctttatgaga
hPDGF-B R actgcacgttgcggttgt
hCOL1a2 F cccagccaagaactggtatagg
hCOL1a2 R ggctgccagcattgatagtttc
hRunx2 F tcttagaacaaattctgcccttt
hRunx2 R tgctttggtcttgaaatcaca
hALP F gacctcctcggaagacactc
hALP R tgaagggcttcttgtctgtg
hOCN F agcaaaggtgcagcctttgt
hOCN R gcgcctgggtctcttcact
hGAPDH F agccacatcgctcagacac
hGAPDH R gcccaatacgaccaaatcc