Skip to main content

Table 1 List of Species-specific primers

From: Relationship between the burden of major periodontal bacteria and serum lipid profile in a cross-sectional Japanese study

Primer set Sequence (5′ to 3′) Size (bp) Detection Limit (No. of cells) Reference
P. gingivalis TGT AGA TGA CTG ATG CTG AAA ACC 197 5 (17)
ACG TCA TCC CCA CCT TCC TC    
T. denticola AAG GCG GTA GAG CCG CTC A 311 10 (18)
AGC CGC TGT CGA AAA GCC CA    
T. forsythia GCG TAT GTA ACC TGC CCG CA 641 25 (15)
TGC TTC AGT GTC AGT TAT ACC T    
P. intermedia TTTGTTGGGGAGTAAAGCGGG 575 25 (15)
TCAACATCTCTGTATCCTGCGT