Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primers sequences used in the Real-time RT-PCR

From: WIF1 enhanced dentinogenic differentiation in stem cells from apical papilla

Gene Symbol Primer Sequences (5′--3′)
GAPDH-F CGAACCTCTCTGCTCCTCCTGTTCG
GAPDH-R CATGGTGTCTGAGCGATGTGG
DSPP-F TTCCGATGGGAGTCCTAGTG
DSPP-R TCTTCTTTCCCATGGTCCTG
DMP1-F GTCCCCTGAGGATGAGAACA
DMP1-R CCTCGCTCTGACTCTCTGCT
OSX-F GCCAGAAGCTGTGAAACCTC
OSX-R AGGGAGATGGGGTACATTCC
WIF1-F CAAAGCAAACTGCTCAACCA
WIF1-R CTCCATTTCGACAGGGTTGT