Skip to main content

Table 1 Primers for polymerase chain reaction

From: Influence of epigallocatechin-3-gallate in promoting proliferation and osteogenic differentiation of human periodontal ligament cells

Gene name Forward primer Reverse primer
COL1 AGAGGAAGGAAAGCGAGGAG GGACCAGCAACACCATCTG
RUNX2 GACGAGGCAAGAGTTTCACC GGTTCCCGAGGTCCATCTAC
OPN GCCGAGGTGATAGTGTGGTT ACTCCTCGCTTTCCATGTGT
OSX CCCACCTCAGGCTATGCTA CACTGGGCAGACAGTCAGAA
GAPDH GCACCGTCAAGGCTGAGAAC TGGTGAAGACGCCAGTGGA
  1. COL1 type I collagen, RUNX2 runt-related transcription factor 2, OPN osteopontin, OSX osterix, GAPDH glyceraldehyde-3-phosphate dehydrogenase