Skip to main content

Table 1 Primer base sequence

From: Luteolin supports osteogenic differentiation of human periodontal ligament cells

Gene Forward (5′-3′) Reverse (5′-3′)
BMP2 TATTTGGATAAGAACCAGACATTG GAAAGAAGAACAACAAACCATCA
OCN AGCAAAGGTGCAGCCTTTGT GCGCCTGGGTCTCTTCACT
RUNX2 GAGATTTGTGGGCCGGAGTG CCTAAATCACTGAGGCGGTC
OSX ACCTACCCATCTGACTTTGCTC CCACTATTTCCCACTGCCTTG
Cyclin D1 TGATGCTGGGCACTTCATCTG TCCAATCATCCCGAATGAGAGTC
β-catenin AAAATGGCAGTGCGTTTAG TTTGAAGGCAGTCTGTCGTA
GAPDH AACGGATTTGGTCGTATTGG TGGAAGATGGTGATGGGATT