Skip to main content

Table 1 Oligonucleotide PCR primer sets used to identify target species and genera in the biofilm by densiometric gel electrophoresis and qPCR. For S. mutans the gtfB gene encoding glucosyltransferase was used. The other primers were for various regions of the 16S rRNA gene

From: Use of an oxygen planar optode to assess the effect of high velocity microsprays on oxygen penetration in a human dental biofilms in-vitro

Sequence of primer (5′–3′) Target and abbreviation Product size Reference
F, GTTGACAGCCGATGAAGAAGATGAA
R, TTCTCAGCAAAAGTACCGTCCTCG
S. oralis (So) 81 bp [34]
F, GCCTACAGCTCAGAGATGCTATTCT
R, GCCATACACCACTCATGAATTGA
S. mutans (Sm) 114 bp [35]
F, GGTGTTGTTTGACCCGTTCAG
R, AGTCCATCCCACGAGCACAG
S. gordonii (Sg) 96 bp [35]
F,ATGTGGGTCTGACCTGCTGCc    R,CAAAGTCGATCACGCTCCGc A. viscosus (Av)c 96 bp [35]
F, GGATAGATGAAAGGTGGCCTCTa
R, CCAACTAGCTAATCAGACGCAATa
V. parvula (Vp)a 72 bp [36]
F, CCGTGATGGGATGGAAACTGCb
R, CCTTCGCCACTGGTGTTCTTCb
Veillonella. spp. (Vspp)b 102 bp [37]
F, CGCAGAAGGTGAAAGTCCTGTAT
R, TGGTCCTCACTGATTCACACAGA
Fusobacterium.spp.
(Fspp)
101 bp [35]
F, TAC CCATCGTCG CCTTGGT
R, CGGACTAAAACCGCATACACTTG
P. gingivalis (Pg) 126 bp [35]
F, CGCTAGTAATCGTGGATCAGAATG
R, TGTGACGGGCGGTGTGTA
Eubacteria (Uni) 69 bp [35]
  1. aused in conventional PCR
  2. bused in qPCR
  3. cdue to uncertainty of taxonomic identification of A. viscosus with respect to identification of this species in human strains we denote this species in quotation marks following Könönen et al. [38]