Skip to main content

Table 1 List of primers used in the study

From: Melatonin antagonizes lipopolysaccharide-induced pulpal fibroblast responses

GenePrimer sequence (5′➔ 3′)Predicted product size (bp)Reference
GAPDHForward: ATGACCCCTTCATTGACCTCA
Reverse: GAGATGATGACCCTTTTGGCT
265Shukla S et al. Int J Oncol. 2009
COX-1Forward: GAGTCTTTCTCCAACGTGAGC
Reverse: ACCTGGTACTTGAGTTTCCCA
350Choi EK et al. FEBS Lett. 2004
COX-2Forward: GCAGTTGTTCCAGACAAGCA
Reverse: CAGGATACAGCTCCACAGCA
359Fernau NS et al. J Biol Chem. 2010
IL-1 βForward: CCAGGGACAGGATATGGAGCA
Reverse: TTCAACACGCAGGACAGGTACAG
129Abe A et al. Pathol Int. 2014.
MT1Forward: GATCCTGGTTGTCCAGGTCA
Reverse: CATTGAGGCAGCTGTTGAAA
241Tachibana R et al. Int J Mol Sci. 2014.
MT2Forward: CAACTGCTGCGAGGCG
Reverse: GGCGGTGGTGACGATG
133Lanoix D et al. Hum Reprod. 2006.