Skip to main content

Table 1  Sequences of primers used in the real-time PCR

From: The expression levels of MicroRNA-146a, RANKL and OPG after non-surgical periodontal treatment

Genes Forward primer (5′-3′) Reverse primer (5′-3′)
OPG GTTTCCGGGGACCACAATGA ACACGGTCTTCCACTTTGCT
RANKL AGAGCAGAGAAAGCGATGGT GATGGGATGTCGGTGGCATTA
GAPDH CTCTGGTAAAGTGGATATTG GGTGGAATCATATTGGAACA
  1. RANKL: receptor activator of nuclear factor-kB ligand; OPG: osteoprotegrin; GAPDH: glyceraldehyde 3 phosphate dehydrogenase