Skip to main content

Table 1 Primer sequences used in real-time PCR

From: Increase in Bifidobacterium is a characteristic of the difference in the salivary microbiota of pregnant and non-pregnant women

Bacteria (16S rRNA) Primer sequences (5′-3′) Reference
Bifidobacterium
F CTCCTGGAAACGGGTGG [17]
R GGTGTTCTTCCCGATATCTACA
B. adolescentis
F GGATCGGCTGGAGCTTGCTCCG [19]
R CCCCGAAGGCTTGCTCCCAGT
P [FAM]CTCCAGTTGGATGCATGTCCTTCTGG[TAM]
B. dentium
F ATCCCGGGGGTTCGCCTCC [19]
R ATACCGATGGAACCTTTCCCGG
P [FAM]TGCTCCGGTTGGATGCATGTCCTTCC[TAM]
P. gingivalis
F AGGCAGCTTGCCATACTGCG [15]
R ACTGTTAGCAACTACCGATGT
P. intermedia
F TTTGTTGGGGAGTAAAGCGGG [18]
R TCAACATCTCTGTATCCTGCGT
A. actinomycetemcomitans
F CTTACCTACTCTTGACATCCGAA [16]
R ATGCAGCACCTGTCTCAAAGC
  1. PCR polymerase chain reaction