Skip to main content

Table 1 PCR primers for genes encoding MMP2, IL-1, Runx2, ALP, COL1a2, OCN and GAPDH

From: In vitro effects of hyaluronic acid on human periodontal ligament cells

Gene Primer Sequence
hMMP2 F ccccaaaacggacaaaga
hMMP2 R cttcagcacaaacaggttgc
hIL-1 F ggttgagtttaagccaatcca
hIL-1 R ggtgatgacctaggcttgatg
hRunx2 F tcttagaacaaattctgcccttt
hRunx2 R tgctttggtcttgaaatcaca
hCOL1a2 F cccagccaagaactggtatagg
hCOL1a2 R ggctgccagcattgatagtttc
hALP F gacctcctcggaagacactc
hALP R tgaagggcttcttgtctgtg
hOCN F agcaaaggtgcagcctttgt
hOCN R gcgcctgggtctcttcact
hGAPDH F agccacatcgctcagacac
hGAPDH R gcccaatacgaccaaatcc