Skip to main content

Table 1 The primer sequences

From: FERMT1 knockdown inhibits oral squamous cell carcinoma cell epithelial-mesenchymal transition by inactivating the PI3K/AKT signaling pathway

Gene Forward primer (5' -3') Reverse primer (5' -3') Size
FERMT1 TAAACTTGCAGATAATCTCA CAAGTTCCTTATTTTTAAAG 118 bp
PI3K(PIK3CB) TAATCGGAGGATAGGGCAGT TTCATGTGCCCCACACTTCC 123 bp
AKT (AKT1) GGTGATCCTGGTGAAGGAGA AAGGGGTGCCTGGAGTTCTG 138 bp
MMP-9 TCTGCCTGCACCACCGACG CTGGGTGTAGAGTCTCTCG 114 bp
E-cadherin CAACGATAATCCTCCGATCT ACGGTGACGGTGGCTGTGGA 138 bp
vimentin GAAGAGGAAATCCAGGAGCT TTTCATATTGCTGACGTACGT 118 bp
N-cadherin TAATGGAAATCAAGT ATCCCTCAGGAACTGTCCCA 113 bp
GAPDH GCTCATTTGCAGGGGGGAG GTTGGTGGTGCAGGAGGCA 138 bp