Skip to main content
Download PDF

Evaluation of delphinidin as a storage medium for avulsed teeth

BMC Oral Health volume 23, Article number: 21 (2023) Cite this article

Abstract

Background

Delphinidin (DP), an anthocyanidin found in blueberries, has antioxidant and anti-inflammatory effects. This study aimed to investigate the efficacy of DP as a storage medium for avulsed teeth.

Methods

Human periodontal ligament cells were cultured and exposed to DP solution (10, 50, and 100 μM), Dulbecco’s modified Eagle’s medium, Hank’s balanced salt solution and tap water. Cell counting kit-8 assays were performed after 0.5, 1, 6, and 24 h to measure the cell viability. Nitric oxide assays and gelatin zymography were performed to evaluate the anti-inflammatory effects of DP. Reverse transcription-polymerase chain reaction was used to determine the expression levels of inflammatory cytokines.

Results

The viability of periodontal ligament cells was greatest at 100 μM DP. At 1 h, 100 μM DP decreased nitric oxide synthesis (p < .0167). Matrix metallopeptidase-9 activity was inhibited by DP in a dose-dependent manner (p < .0167). Moreover, treatment with 100 μM DP decreased the expression levels of tumor necrosis factor (TNF)-α, interleukin (IL)-6, and IL-8 in periodontal ligament cells (p < .0167).

Conclusions

Within the limits of this study, DP preserved the viability and suppressed the inflammatory response of periodontal ligament cells. These findings suggest that DP could be promising for preservation of avulsed teeth.

Peer Review reports

Background

Tooth avulsion is a type of traumatic dental injury in which a tooth is completely displaced from its socket. To promote the healing of avulsed teeth, immediate replantation is advised [1]. In a previous clinical study, favorable healing was observed in the majority of immediate replantation cases, whereas only 18% of delayed replantation cases showed favorable healing [2]. It is crucial to preserve the viability of the periodontal ligament (PDL) cells of avulsed teeth to achieve a favorable prognosis. Until the teeth are replanted, avulsed teeth should be stored in a suitable storage medium to keep PDL cells viable. Previous studies have suggested easily available products in markets to preserve the avulsed teeth, including Gatorade (Thirst Quencher Starfruit, Gatorade, Chicago, IL), contact lens solution, Save-a-tooth (Phoenix-Lazerus Inc., Shartlesville PA, USA), and EMT Toothsaver (SmartPractice.com, Phoenix, AZ, USA) [3,4,5]. Several studies have also reported natural compounds such as propolis, red mulberry, green tea extract as potential storage media for avulsed teeth [6,7,8,9]. However, previous studies regarding natural compounds on this topic have mainly focused on cell viability testing rather than anti-inflammatory effects in relation to PDL cell preservation.

Delphinidin (DP) is an anthocyanidin found in blueberries and other pigment-rich vegetables. DP has anti-inflammatory and antioxidant properties [10]. Many hydroxyl groups can be found in the molecular structure of DP. The 3-dihydroxyl structure of the B-ring is responsible for the majority of its antioxidative effect [11]. According to a previous study that evaluated the antioxidative activity of anthocyanins, DP exhibited the highest radical-neutralizing potency [12]. DP exerts inhibitory effects on pro-inflammatory cytokines in tumor necrosis factor (TNF)-α-exposed human rheumatoid arthritis synovial cells by downregulating the nuclear factor (NF)-κB pathway [13]. Furthermore, in osteoarthritic chondrocytes, DP reduced the expression of cyclooxygenase-2 mRNA and the production of prostaglandin E2 induced by interleukin (IL)-1β, which is also related to external root resorption [14, 15].

DP showed favorable effects in inflammatory conditions. In this sense, we hypothesized that DP could exert anti-inflammatory, antioxidant, and cell-preserving effects on PDL cells of avulsed teeth. Therefore, this study aimed to evaluate the biological effects of DP on human PDL cells as a candidate for a storage medium for avulsed teeth. The null hypothesis was that DP treatment had no impact on inflammatory responses of PDL cells.

Methods

Cell culture of human PDL cells

Human periodontal ligament fibroblasts (CAT No. 2630) cells were purchased from ScienCell Research Laboratories (Young Sciences Inc. Seoul, Korea) and cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco BRL, Life technologies, Grand Island, NY) with 10% fetal bovine serum, 100 U/mL penicillin, and 100 μg/mL streptomycin at 37 °C and 5% CO2. Cell culture medium was exchanged every 2 days. Cells at passage 4 were used for subsequent experiments.

Preparation of PDL cell storage media

DP was purchased from Sigma Aldrich (Seoul, Korea) and dissolved in dimethyl sulfoxide at a stock concentration of 10 mM. DP solutions (10, 50, and 100 μM) were prepared by diluting the DP stock solution in DMEM. A pure DMEM (0 μM DP) and Hank’s balanced salt solution (HBSS; Sigma-Aldrich, Seoul, Korea) were used as positive controls. Tap water was also tested as a negative control.

Cell viability test

The viability of PDL cells was measured using the cell counting kit-8 assay (CCK-8; Dojindo Molecular Technologies), as described previously [16]. PDL cells were seeded into a 96-well plate at 5 × 103 cells/well in 200 μL of culture media. After incubation for 24 h for cell adhesion, the culture media was replaced with the prepared storage media: (a) DMEM (0 μM DP), (b) 10 μM DP, (c) 50 μM DP, (d) 100 μM DP, (e) HBSS, and (f) tap water. Cells were exposed to the medium for 30 min and 1, 6, and 24 h. Then, 20 μL of CCK-8 solution was added to the plates and incubated for 2 h at 37 °C. Cell viability was determined by measuring the optical density at 450 nm using a Benchmark Plus Multiplate Spectrophotometer (Bio-Rad, Hercules, CA, USA). Relative cell viability was compared to the differences in optical density.

Nitric oxide (NO) assay

First, 2 × 105 PDL cells were seeded into a 6-well plate and incubated at 37 °C with 5% CO2 for 24 h. The culture medium was removed from the wells. Based on the results of the cell viability test, 2 mL of DMEM (0 μM DP) and DP solutions at concentrations of 50 μM and 100 μM were tested. After either 1 or 6 h storage, cell supernatants were collected from the well of DMEM after 1 h storage, 50 and 100 μM DP solution after 1 h storage, DMEM after 6 h storage, and 50 and 100 μM DP solution after 6 h storage. Then, NO assay was performed using NO Plus Detection Kit (iNtRON Biotechnology, Inc., Seoul, Korea). Briefly, each 100 μL of supernatant was mixed with N1 buffer (50 μL) in 96-well plate. Next, 50 μM of N2 buffer was applied to the plate after 10 min. The absorbance of each well was measured at 540 nm. Quantification of Nitrite concentration was calculated based on a nitrite standard curve according to the manufacturer's protocol. All assays were performed in triplicate.

Assessment of the matrix metallopeptidase (MMP)-9 activity via gelatin zymography

Gelatin zymography was performed to assess the MMP-9 activity. Same cell supernatants as NO assay were used for gelatin zymography. For each sample, the cell supernatant was mixed at a 1:4 (sample buffer:cell supernatant) ratio with non-reducing sample buffer (125 mM Tris–HCl (pH 6.8), 2% SDS, 10% glycerol, and 0.001% bromophenol blue) and electrophoresed on 10% polyacrylamide gels containing 0.3% gelatin. After electrophoresis, the gels were washed twice with 2.5% Triton X-100 for 30 min at room temperature and incubated 24 h at 37 °C in an incubation buffer containing 50 mM Tris–HCl (pH 7.5), 10 mM CaCl2, and 0.01% NaN3. The gels were stained with 0.25% Coomassie Blue R-250 and destained with 5% methanol and 8% acetic acid. Gelatinolytic bands were observed as clear zones against a blue background, and the intensity of the bands was estimated using the ImageJ software (National Institutes of Health, Bethesda, MD, USA). All zymography tests were performed in triplicate.

RNA isolation and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

According to the manufacturer’s instructions, an AccuPrep Universal RNA Extraction Kit (K-3140, K-3141; Bioneer, Daejeon, Korea) was used to extract RNA from the same cells which had used for NO assay and gelatin zymography. 400 μL of RB buffer was added and vortexed. 300 μL of ethanol (80%) was then added and subsequently mixed with a pipette. Each sample was transferred to a binding column and centrifuged at 14,000 rpm for 20 s. After adding 700 μL of RWA 1 buffer to each tube and centrifuging at 14,000 rpm for 20 s, the remaining solution was discarded. After that, 500 μL of RWA 2 buffer was added and centrifuged at 14,000 rpm for 20 s. To remove ethanol, each column was centrifuged for 1 min. For elution, the columns were transferred to fresh 1.5 mL tubes with 50–200 μL of ER buffer and was centrifuged at 10,000 rpm for 1 min.

Next, RT-qPCR was performed. Briefly, 5 μg of total RNA was converted into complementary DNA (cDNA) using a MiniAmp Plus Thermal Cycler. Next, the QuantStudio 5 Real-Time PCR Ultimate Simplicity System was used to measure SYBR green fluorescence with a commercial reagent (Power SYBR Green Master Mix; Thermo Fisher Scientific, Carlsbad, CA, USA). The cycling conditions were as follows: denaturation for 10 min at 95 °C, followed by 40 amplification cycles of denaturation for 10 s at 95 °C and annealing for 45 s at 59 °C. cDNA levels were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) levels using the 2–ΔΔCt method. The primer sequences used for PCR were as follows: TNF-α, (F) 5′—CTCTTCTGCCTGCTGCACTTTG—3′, (R) 5′—ATGGGCTACAGGCTTGTCACTC—3′; IL-6, (F) 5′—AGACAGCCACTCACCTCTTCAG –3′, (R) 5′—TTCTGCCAGTGCCTCTTTGCTG—3′; IL-8, (F) 5′—GAGAGTGATTGAGAGTGGACCAC—3′, (R) 5′—CACAACCCTCTGCACCCAGTTT—3′; GAPDH, (F) 5′—GTCTCCTCTGACTTCAACAGCG—3′, (R) 5′—ACCACCCTGTTGCTGTAGCCAA—3. All experiments were performed in triplicate.

Statistical analysis

Statistical analysis was conducted using one-way analysis of variance followed by Tukey’s HSD post-hoc test using SPSS software (Version 21.0; IBM Corp., Armonk, NY, USA). Data are expressed as the mean ± standard error of the mean. P-values < 0.0167 with Bonferroni corrections were considered to be statistically significant.

Results

Figure 1 shows the average absorbance values for the viability of PDL cells stored in each storage medium. At all storage time periods, DMEM and DP solutions showed higher optical densities than HBSS and tap water. In addition, at all storage time periods, 100 μM DP solution had the highest average absorbance value, followed by 50 μM DP solution at all storage time periods, except 24 h.

Fig. 1
figure 1

Mean optical density (450 nm), which represents the periodontal ligament (PDL) cell viability for each storage medium at different storage time points

Full size image

In the 1 h storage NO detection experiment, PDL cells treated with 100 μM DP solution produced significantly less NO than those treated with DMEM and 50 μM DP solution. The concentration of NO decreased as the DP concentration increased. (Fig. 2a). At 6 h storage, there was no significant difference in NO detection among the DMEM, 50 μM DP, and 100 μM DP solution-treated groups. However, when the concentration of DP was increased, the production of NO was decreased (Fig. 2b).

Fig. 2
figure 2

Nitric oxide (NO) production in the storage medium was analyzed using the NO detection kit. Data are presented as the mean ± standard error of the mean, n = 3. A At 1 h experiment, *p < .0167 compared with 50 and 100 μM DP solution groups, #p < .01 compared to DMEM and 100 μM DP solution groups. B After 6 h, there were no significant differences

Full size image

Zymography demonstrated that the main gelatinase released by PDL cells migrated at 84 kDa, which is representative of active MMP-9, as shown in Fig. 3a. However, gelatinolytic bands at 72 kDa (MMP-2 pro-form), 62 kDa (MMP-2 active form), and 92 kDa (MMP-9 pro-form) were infrequently observed. These experiments showed that the suppression of MMP-9 activity was more pronounced in the 50 and 100 μM DP solution groups than in the DMEM group. In both 1 and 6 h experiments, the activity of MMP-9 was significantly inhibited by DP (Fig. 3b and c).

Fig. 3
figure 3

Determination of MMP-9 activity under DP treatment. Data are presented as the mean ± standard error of the mean, n = 3. A Zymography of PDL cells under DP treatment. Activity of MMP-9 in each storage media was determined by gelatin zymogram. B Densitometric comparsion of relative MMP-9 activity at 1 h. C Densitometric comparsion of relative MMP-9 activity at 6 h. *p < .0167 and #p < .01 indicated that the difference between groups was statistically significant

Full size image

At 1 h of storage, RT-qPCR analysis showed that the relative gene expression levels of IL-6 in 50 and 100 μM DP solution groups decreased significantly compared to those in the DMEM group (Fig. 4). Although there was no significant difference between the groups in terms of the expression levels of TNF-α and IL-8, the relative expression levels in 50 and 100 μM DP solution groups were downregulated compared to those in the DMEM group. RT-qPCR analysis after 6 h of storage revealed that the 50 and 100 μM DP solution groups had considerably lower relative gene expression of TNF-α than the DMEM group. The expression of IL-6 did not differ significantly across the groups. IL-8 expression was considerably decreased in the 100 μM DP solution group than in the DMEM and 50 μM DP solution groups, although 50 μM DP solution did not significantly differ from the DMEM group.

Fig. 4
figure 4

Relative expression levels of pro-inflammatory mediators. The expression levels of A TNF-α at 1 h B. TNF-α at 6 h, C IL-6 at 1 h, D IL-6 at 6 h, E IL-8 at 1 h, F IL-8 at 6 h were analyzed using RT-qPCR. Data are presented as the mean ± standard error of the mean, n = 3. *p < .0167, #p < .01, ##p < .001 indicated that the difference between groups was statistically significant

Full size image

Discussion

Our results showed that DP preserved the viability of PDL cells via anti-inflammatory effects. DP exerted anti-inflammatory effects on PDL cells by inhibiting the expression of MMP-9, TNF-α, IL-6, and IL-8.

Between immediate and delayed replantation, different levels of PDL healing of avulsed teeth are observed. These differences largely depend on the inflammatory response of PDL tissue. A previous study that evaluated the biological responses of PDL tissue following immediate and delayed replantation found a significant relationship between TNF-α signaling via the NF-κB pathway and differences in the healing responses of the periodontal tissues of replanted teeth [17]. Therefore, immediate replantation is the best option for a good prognosis in avulsed teeth [18]. However, replanting an avulsed tooth is frequently postponed because of insufficient knowledge or confidence in the replantation procedure [19, 20]. If the replantation of an avulsed tooth is delayed, root resorption in such tooth may occur [21].

To ensure the viability of PDL cells when the replantation of the avulsed tooth is delayed, the tooth should be maintained in an appropriate storage medium [22, 23]. Tooth storage media for avulsed teeth must be capable of retaining cell viability, have physiological pH and osmolality similar to that in the oral environment, provide nutrition and growth factors for cell metabolism, and be readily available and accessible [24, 25]. Storing the avulsed tooth in an antioxidant-rich storage medium may help to lower the rates of root resorption following replantation [26]. Addition of anti-inflammatory characteristics to storage media may aid in preventing root resorption and improving the results of replanted teeth. Thus, we selected DP, which exerts antioxidant and anti-inflammatory effects, for subsequent experiments.

Previous studies have demonstrated that 100 μM DP has anti-inflammatory and cell-preserving effects in human cells [27, 28]. In this study, 100 μM DP showed the highest PDL cell viability, which was consistent with the studies. To determine whether DP exerts anti-inflammatory effects on PDL cells, NO generation by DP was tested, and a significant reduction in NO production was detected.

RT-qPCR and zymography were performed to further study the anti-inflammatory effects of DP on particular inflammatory mediators. Based on zymography data, DP considerably reduced the MMP-9 activity in a dose-dependent manner. Increased MMP-9 activity is associated with inflammatory processes, especially when the destruction of periodontal tissue is severe [29]. Bone resorption is directly correlated with MMP-9 production of the osteoclasts [30]. Ahn et al. [19] demonstrated that extra-oral time affected the expression levels of inflammatory cytokines and MMPs in replanted rat teeth. Additionally, there was a positive correlation between MMP-9 expression and longer extra-oral periods in rat teeth that had been replanted. These results suggest that DP can reduce MMP-9 expression, which in turn can reduce the inflammatory response of avulsed teeth following delayed replantation. Along with MMP-9, MMP-2 is a well-known gelatinase that is involved several inflammatory processes, collagen remodeling, and alveolar bone regeneration [31]. MMP-2 expression, however, was not detected in the zymography used in this study. This indicates that in contrast to the in vitro avulsion model, MMP-2 may be more engaged in bone turnover or remodeling of the extracellular matrix [32].

In this study, RT-qPCR analysis showed that DP significantly reduced the expression levels of pro-inflammatory cytokines, such as TNF-α, IL-6, and IL-8. These results suggest that DP exerts anti-inflammatory effects. In our study, DP significantly inhibited TNF-α expression. Previous studies using DP support this finding [14, 33]. Another study found that delphinidin-3-O-glucoside prevents the interaction of TNF-proteins by directly binding to the TNF-receptor [34]. TNF-α is a key pro-inflammatory mediator in periodontal tissue destruction [35]. Other pro-inflammatory mediators, such as IL-1β, IL-6, IL-8, and MMPs, are produced as a result of TNF-α production [33]. TNF-α significantly reduces the PDL cell migration and inhibits PDL regeneration [36]. A previous RNA-seq study demonstrated that PDL cells stored for a long time, even when stored in HBSS or milk, could experience an inflammatory response [16]. This RNA-seq study further showed that the TNF-α signaling pathway was significantly remarked in this response.

Additionally, IL-6 and IL-8 play significant roles in the development of inflammatory responses, osteoclast production, and alveolar bone resorption [37]. IL-1β, IL-6, and TNF-α induce classical hallmarks of inflammation, and they cooperate with one another in their actions [38]. In this study, DP significantly inhibited the expression of IL-6 and IL-8, which was consistent with previous studies. In a previous study, rats with spinal cord injuries received (DP) therapy, which markedly decreased their levels of TNF-α and IL-6 activity [39]. In another study on the effects of topical DP treatment on inflammatory skin disease, DP treatment reduced lesion size and mRNA expression levels of the inflammatory cytokines, TNF-α, IL-6, and IL-8 [40]. Similarly, DP treatment reduced IL-6, IL-8, and TNF-α production in a 3D human skin model [41].

However, our study has some limitations. First, the clinical scenarios of avulsed teeth were not completely simulated. Further studies are needed to determine the effect of DP on PDL cells that have been bench-dried prior to DP treatment. Next, our study only evaluated the effect of DP at the cellular level. To further clarify the efficacy of DP as a storage medium for avulsed teeth, animal and human studies will be conducted in the future.

Conclusions

In conclusion, this study demonstrates that DP may exert therapeutic effects on PDL tissues of avulsed teeth before delayed replantation. This suggests that DP can maintain the survival of PDL cells and prevent inflammatory reactions in delayed replanted teeth. Future studies using animal models are needed to evaluate the potential of DP in vivo.

Availability of data and materials

All data generated or analyzed from this study are included in this published article.

Abbreviations

PDL:

Periodontal ligament

DP:

Delphinidin

TNF-α:

Tumor necrosis factor-α

IL-1β:

Interleukin-1β

DMEM:

Dulbecco’s modified Eagle’s medium

HBSS:

Hank’s balanced salt solution

CCK-8:

Cell counting kit-8

NO:

Nitric oxide

MMP-9:

Matrix metallopeptidase-9

RT-qPCR:

Reverse transcription-quantitative polymerase chain reaction

cDNA:

Complementary DNA

References

  1. Fouad AF, Abbott PV, Tsilingaridis G, Cohenca N, Lauridsen E, Bourguignon C, O’Connell A, Flores MT, Day PF, Hicks LJ. International Association of Dental Traumatology guidelines for the management of traumatic dental injuries: 2. Avulsion of permanent teeth. Dent Traumatol. 2020;36(4):331–42.

    Article  Google Scholar 

  2. Andreasen J, Borum MK, Jacobsen H, Andreasen FJ. Replantation of 400 avulsed permanent incisors. 4. Factors related to periodontal ligament healing. Dent Traumatol. 1995;11(2):76–89.

    Article  Google Scholar 

  3. Sigalas E, Regan JD, Kramer PR, Witherspoon DE, Opperman LA. Survival of human periodontal ligament cells in media proposed for transport of avulsed teeth. Dent Traumatol. 2004;20(1):21–8.

    Article  Google Scholar 

  4. Al-Nazhan S, Al-Nasser A. Viability of human periodontal ligament fibroblasts in tissue culture after exposure to different contact lens solutions. J Contemp Dent Pract. 2006;7(4):37–44.

    Article  Google Scholar 

  5. Lee W: Viability of human periodontal ligament fibroblasts after storage in Save-A-Tooth, EMT toothsaver and Hank's Balanced Salt Solution. Marquette University; 2016.

  6. Gjertsen AW, Stothz KA, Neiva KG, Pileggi R. Effect of propolis on proliferation and apoptosis of periodontal ligament fibroblasts. Oral Surg Oral Med Oral Pathol Oral Radiol Endodontol. 2011;112(6):843–8.

    Article  Google Scholar 

  7. Saxena P, Pant VA, Wadhwani KK, Kashyap MP, Gupta SK, Pant AB. Potential of the propolis as storage medium to preserve the viability of cultured human periodontal ligament cells: an in vitro study. Dent Traumatol. 2011;27(2):102–8.

    Article  Google Scholar 

  8. Özan F, Tepe B, Polat ZA, Er K. Evaluation of in vitro effect of Morus rubra (red mulberry) on survival of periodontal ligament cells. Oral Surg Oral Med Oral Pathol Oral Radiol Endodontol. 2008;105(2):e66–9.

    Article  Google Scholar 

  9. Hwang JY, Choi SC, Park JH, Kang SW. The use of green tea extract as a storage medium for the avulsed tooth. J Endod. 2011;37(7):962–7.

    Article  Google Scholar 

  10. Patel K, Jain A, Patel DK. Medicinal significance, pharmacological activities, and analytical aspects of anthocyanidins ‘delphinidin’: a concise report. J Acute Dis. 2013;2(3):169–78.

    Article  Google Scholar 

  11. Yi L, Chen CY, Jin X, Mi MT, Yu B, Chang H, Ling WH, Zhang T. Structural requirements of anthocyanins in relation to inhibition of endothelial injury induced by oxidized low-density lipoprotein and correlation with radical scavenging activity. FEBS Lett. 2010;584(3):583–90.

    Article  Google Scholar 

  12. Kähkönen MP, Heinonen M. Antioxidant activity of anthocyanins and their aglycons. J Agric Food Chem. 2003;51(3):628–33.

    Article  Google Scholar 

  13. Seong A-R, Yoo J-Y, Choi K, Lee M-H, Lee Y-H, Lee J, Jun W, Kim S, Yoon H-G. Communications BR: Delphinidin, a specific inhibitor of histone acetyltransferase, suppresses inflammatory signaling via prevention of NF-κB acetylation in fibroblast-like synoviocyte MH7A cells. Biochem Biophys Res Commun. 2011;410(3):581–6.

    Article  Google Scholar 

  14. Haseeb A, Chen D, Haqqi TM. Delphinidin inhibits IL-1β-induced activation of NF-κB by modulating the phosphorylation of IRAK-1Ser376 in human articular chondrocytes. Rheumatology. 2013;52(6):998–1008.

    Article  Google Scholar 

  15. Grootveld M, Lynch E, Page G, Chan W, Percival B, Anagnostaki E, Mylona V, Bordin-Aykroyd S, Grootveld KL. Potential advantages of peroxoborates and their ester adducts over hydrogen peroxide as therapeutic agents in oral healthcare products: chemical/biochemical reactivity considerations in vitro, ex vivo and in vivo. Dent J (Basel). 2020. https://doi.org/10.3390/dj8030089.

    Article  Google Scholar 

  16. Nam OH, Oh TJ, Lee JH, Hwang YS, Choi SC. Differential gene expression profiles of human periodontal ligament cells preserved in Hank’s balanced salt solution and milk. Dent Traumatol. 2020;36(1):58–68.

    Article  Google Scholar 

  17. Chae YK, Shin SY, Kang SW, Choi SC, Nam OH. Differential gene expression profiles of periodontal soft tissue from rat teeth after immediate and delayed replantation: a pilot study. J Periodontal Implant Sci. 2022;52(2):127–40.

    Article  Google Scholar 

  18. Andreasen JO. Effect of extra-alveolar period and storage media upon periodontal and pulpal healing after replantation of mature permanent incisors in monkeys. Int J Oral Surg. 1981;10(1):43–53.

    Article  Google Scholar 

  19. Ahn HJ, Nam OH, Lee HS, Kim EC, Cohenca N, Choi SC. Expression of inflammatory cytokines and MMPs on replanted teeth at different extra-alveolar time: an ex vivo and in vivo study. Int J Pediatr Dent. 2016;26(4):301–9.

    Article  Google Scholar 

  20. Nam OH, Cheon K, Kim MS, Lee HS, Choi SC. Evaluation of the periodontal and pulpal healing of replanted rat molars with doxycycline root conditioning. J Periodontal Implant Sci. 2019;49(3):148–57.

    Article  Google Scholar 

  21. Heboyan A, Avetisyan A, Karobari MI, Marya A, Khurshid Z, Rokaya D, Zafar MS, Fernandes GVO. Tooth root resorption: a review. Sci Prog. 2022;105(3):368504221109217.

    Article  Google Scholar 

  22. Khademi AA, Saei S, Mohajeri MR, Mirkheshti N, Ghassami F, Torabinia N, Alavi SA. A new storage medium for an avulsed tooth. J Contemp Dent Pract. 2008;9(6):25–32.

    Article  Google Scholar 

  23. Martins WD, Westphalen VP, Westphalen FH. Tooth replantation after traumatic avulsion: a 27-year follow up. Dent Traumatol. 2004;20(2):101–5.

    Article  Google Scholar 

  24. Khinda VI, Kaur G, Brar GS, Kallar S, Khurana H. Clinical and practical implications of storage media used for tooth avulsion. Int J Clin Pediatr Dent. 2017;10(2):158–65.

    Article  Google Scholar 

  25. Poi WR, Sonoda CK, Martins CM, Melo ME, Pellizzer EP, de Mendonca MR, Panzarini SR. Storage media for avulsed teeth: a literature review. Braz Dent J. 2013;24(5):437–45.

    Article  Google Scholar 

  26. Buttke TM, Trope M. Effect of catalase supplementation in storage media for avulsed teeth. Dent Traumatol. 2003;19(2):103–8.

    Article  Google Scholar 

  27. Masheta D, Al-azzawi S. Antioxidant and anti-inflammatory effects of delphinidin on glial cells and lack of effect on secretase enzyme. IOP Conf Series Mater Sci Eng. 2018;454: 012061.

    Article  Google Scholar 

  28. Ni T, Yang W, Xing Y. Protective effects of delphinidin against H(2)O(2)-induced oxidative injuries in human retinal pigment epithelial cells. 2019. Biosci Rep. https://doi.org/10.1042/BSR20190689.

  29. Hernández Ríos M, Sorsa T, Obregón F, Tervahartiala T, Valenzuela MA, Pozo P, Dutzan N, Lesaffre E, Molas M, Gamonal J. Proteolytic roles of matrix metalloproteinase (MMP)-13 during progression of chronic periodontitis: initial evidence for MMP-13/MMP-9 activation cascade. J Clin Periodontol. 2009;36(12):1011–7.

    Article  Google Scholar 

  30. Gu JH, Tong XS, Chen GH, Liu XZ, Bian JC, Yuan Y, Liu ZP. Regulation of matrix metalloproteinase-9 protein expression by 1α, 25-(OH)2D3 during osteoclast differentiation. J Vet Sci. 2014;15(1):133–40.

    Article  Google Scholar 

  31. Sternlicht MD, Werb Z. How matrix metalloproteinases regulate cell behavior. Annu Rev Cell Dev Biol. 2001;17:463–516.

    Article  Google Scholar 

  32. Lima T, Amaro RG, Dos Santos LCM, Coste SC, Silva EFE, Barbato-Ferreira DA, Colosimo EA, Silva TAD, Bastos JV. Expression of matrix metalloproteinases 2 and 9 in replanted teeth with external root resorption: a cross-sectional study. Arch Oral Biol. 2021;129: 105194.

    Article  Google Scholar 

  33. Wang S, Liu J, Zhang J, Lin J, Yang S, Yao J, Du M. Glycemic control and adipokines after periodontal therapy in patients with Type 2 diabetes and chronic periodontitis. Braz Oral Res. 2017;31: e90.

    Article  Google Scholar 

  34. Sari DRT, Cairns JRK, Safitri A, Fatchiyah F. Virtual prediction of the delphinidin-3-O-glucoside and Peonidin-3-O-glucoside as Anti-inflammatory of TNF-α signaling. Acta Inform Med AIM J Soc Med Inform Bosnia Herzeg Cas Drus za Med Inform BiH. 2019;27(3):152–7.

    Google Scholar 

  35. Li W, Yu B, Li M, Sun D, Hu Y, Zhao M, Cui CB, Hou S. NEMO-binding domain peptide promotes osteoblast differentiation impaired by tumor necrosis factor alpha. Biochem Biophys Res Commun. 2010;391(2):1228–33.

    Article  Google Scholar 

  36. Takemura A, Nakagawa I, Kawai S, Inaba H, Kato T, Hamada S, Amano A. Inhibitory effects of tumor necrosis factor-alpha on migration of human periodontal ligament cells. J Periodontol. 2006;77(5):883–90.

    Article  Google Scholar 

  37. Graves DT, Oates T, Garlet GP. Review of osteoimmunology and the host response in endodontic and periodontal lesions. J Oral Microbiol. 2011. https://doi.org/10.3402/jom.v3i0.5304.

    Article  Google Scholar 

  38. Uematsu S, Mogi M, Deguchi T. Interleukin (IL)-1 beta, IL-6, tumor necrosis factor-alpha, epidermal growth factor, and beta 2-microglobulin levels are elevated in gingival crevicular fluid during human orthodontic tooth movement. J Dent Res. 1996;75(1):562–7.

    Article  Google Scholar 

  39. Wang CH, Zhu LL, Ju KF, Liu JL, Li KP. Anti-inflammatory effect of delphinidin on intramedullary spinal pressure in a spinal cord injury rat model. Exp Ther Med. 2017;14(6):5583–8.

    Google Scholar 

  40. Pal HC, Chamcheu JC, Adhami VM, Wood GS, Elmets CA, Mukhtar H, Afaq F. Topical application of delphinidin reduces psoriasiform lesions in the flaky skin mouse model by inducing epidermal differentiation and inhibiting inflammation. Br J Dermatol. 2015;172(2):354–64.

    Article  Google Scholar 

  41. Chamcheu JC, Pal HC, Siddiqui IA, Adhami VM, Ayehunie S, Boylan BT, Noubissi FK, Khan N, Syed DN, Elmets CA, et al. Prodifferentiation, anti-inflammatory and antiproliferative effects of delphinidin, a dietary anthocyanidin, in a full-thickness three-dimensional reconstituted human skin model of psoriasis. Skin Pharmacol Physiol. 2015;28(4):177–88.

    Article  Google Scholar 

Download references

Acknowledgements

Not applicable.

Funding

This work was supported by a grant from Kyung Hee University in 2021 (KHU-20211862) and also supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIT) (No. 2020R1C1C1006937).

Author information

Author notes

  1. Ok Hyung Nam and Sang Tae Ro contributed equally to this work as first authors

Authors and Affiliations

  1. Department of Pediatric Dentistry, School of Dentistry, Kyung Hee University, Seoul, Korea

    Ok Hyung Nam & Sung Chul Choi

  2. Department of Pediatric Dentistry, Kyung Hee University College of Dentistry, Kyung Hee University Medical Center, Seoul, Korea

    Ok Hyung Nam, Yong Kwon Chae, Ko Eun Lee & Sung Chul Choi

  3. Department of Dentistry, Graduate School, Kyung Hee University, Seoul, Korea

    Sang Tae Ro, Jaeki Jeong & Yong Kwon Chae

  4. Department of Pharmacology, School of Dentistry, Kyung Hee University, Seoul, Korea

    Hyeon-Woo Lee

  5. Department of Oral and Maxillofacial Pathology, School of Dentistry, Kyung Hee University, 26 Kyungheedae-Ro, Dongdaemun-Gu, Seoul, 02447, Korea

    Sang Wook Kang

Authors
  1. Ok Hyung Nam
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Sang Tae Ro
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Hyeon-Woo Lee
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Jaeki Jeong
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Yong Kwon Chae
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Ko Eun Lee
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Sung Chul Choi
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Sang Wook Kang
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

OHN: Conceptualization, Methodology, Writing/original draft preparation, Funding acquisition, Supervision; STR: Data curation, Formal analysis, Writing/original draft preparation; H-WL: Supervision, Resources; JJ: Formal analysis; YKC: Formal analysis, Writing/original draft preparation; KEL: Formal analysis, Writing/original draft preparation; SCC: Supervision; SWK: Conceptualization, Methodology, Writing/original draft preparation, Funding acquisition, Supervision, Project administration. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Sang Wook Kang.

Ethics declarations

Ethics approval and consent to participate

This study was performed in accordance with the Declaration of Helsinki. This study protocol was reviewed and approved by the Ethics Committee of Kyung Hee University Dental Hospital, Kyung Hee University (KH-DT22010).

Consent for publication

Not applicable.

Competing interests

The authors declare no conflicts of interest.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Nam, O.H., Ro, S.T., Lee, HW. et al. Evaluation of delphinidin as a storage medium for avulsed teeth. BMC Oral Health 23, 21 (2023). https://doi.org/10.1186/s12903-023-02713-9

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12903-023-02713-9

Keywords

BMC Oral Health

ISSN: 1472-6831

Contact us