Skip to main content
Download PDF

Evaluation of the association between TNF-α-1031 T/C polymorphism with oral lichen planus disease

BMC Oral Health volume 24, Article number: 189 (2024) Cite this article

Abstract

Background

Oral lichen planus (OLP) is a T-cell-mediated autoimmune disease that affects the epithelial cells of the oral cavity. This study was performed to investigate any possible relationship between − 1031(T/C) polymorphism (rs1799964) of the tumor necrosis factor α (TNF-α) gene with the risk and severity of oral lichen planus (OLP) disease among an Iranian population.

Method

Saliva samples were collected from 100 patients with OLP and a similar number of healthy controls (age and sex-matched). Then, DNA was extracted from the collected samples for genotyping TNF-α-1031 T/C polymorphism using the PCR-CTPP method. The results were assessed using SPSS software.

Results

The findings revealed a significantly higher prevalence of the C allele in OLP patients (53%) compared to healthy controls (36%), suggesting an association between TNF-alpha gene polymorphism and OLP. A multivariate logistic regression analysis supported this finding, as the presence of the C allele was significantly associated with an increased risk of OLP [χ2 = 4.17, p = 0.04, 95% CI = 1.01–2.65, OR = 1.64]. However, our data indicated no significant association between TNF-alpha-1031 T/C gene polymorphism and OLP severity.

Conclusions

These findings provide the first evidence supporting a possible role of TNF-α-1031 T/C gene polymorphism in OLP susceptibility in the Iranian population. The findings of this study demonstrate a positive association between TNF-α-1031 C/T allele distribution and the risk of OLP disease in the Iranian population. Therefore, carrying the C allele may increase the susceptibility to OLP disease.

Peer Review reports

Background

Lichen planus is a common chronic inflammatory mucosal and skin disorder that affects approximately 0.5–4% of the worldwide population, with a malignant transformation rate of 1.4% [1, 2]. Also, OLP had a higher prevalence among middle-aged females [3, 4], while it is also rare in children (0.03%) [5]. Patients often are unaware of their oral condition [6]. Compared to the cutaneous form of this disease, oral involvement is more frequent and treatment-resistant [7]. Oral lichen planus (OLP) forms white lines or plaques, erythema, erosion, or blisters that mainly affect the buccal mucosa, tongue, and gums. Lesions are usually bilateral and often appear as a combination of clinical subtypes [8]. Clinically, OLP contains various forms, including reticular, erosive, papular, atrophic, plaque-like, and bullous presentations [9]. Reticular and erosive forms are the most common types of oral lichen planus [10]. According to the studies, OLP could increase the risk of oral squamous cell carcinoma, which is an oral potentially malignant disorder [11, 12]. A more significant malignant potential has been identified for the atrophic and erosive forms of OLP [6]. The etiology of OLP disease is still debated. However, the immune-response pathogenesis of this disease has been recognized [5]. Some studies have indicated intrinsic and extrinsic factors such as dental materials, some medications, stress, liver diseases, hepatitis C virus infection, tobacco, alcohol consumption, and genetic factors that could be involved in OLP susceptibility [6, 13, 14]. Substantial evidence suggests that OLP is triggered by an antigen that alters keratinocyte antigen expression or unmasking of an antigen, making them susceptible to cell-mediated autoimmune reactions [15]. Following, it induces the migration of T lymphocytes (mostly CD8+, and some CD4 + cells) into the epithelium and the production of T helper 1 (Th1) cytokines, such as interleukin-2, interferon-gamma and tumor necrosis factor [16], which determine the keratinocytes apoptosis, mucosal basement membrane destruction and long-term chronicity of the disease [15, 17]. Cytokines, such as tumor necrosis factor-α (TNF-α), a pro-inflammatory cytokine and potent immune system inducer, are thought to play a pivotal role in the development of OLP and other autoimmune and inflammatory diseases [18]. Elevated serum TNF-α levels have been observed in OLP patients compared to healthy controls [11]. So far, several single nucleotide polymorphisms (SNPs) within the promoter sequence (-238, -244, -308, -376, -489, -575, -610, -851, -857, -863, -1031) of the TNF-α gene have been reported that affect transcriptional regulation and therefore susceptibility of different diseases [19, 20]. The SNP that occurs in the regulatory position − 1031, the promoter of the TNF-α gene, is characterized by the substitution of cytosine for thymine [21]. This polymorphism change could be related to the up-regulation of TNF-α and cause its increase in blood circulation [19, 21,22,23]. No study has investigated the association of TNF-α -1031 polymorphism with OLP susceptibility and severity in an Iranian population. Therefore, our study aims to address this knowledge gap and explore the potential link between TNF-α gene − 1031 T/C polymorphism and OLP in the Iranian population.

Methods

Sample collection and ethics

Ethical approval was obtained from the Medical Ethics Committee of Kermanshah University of Medical Sciences with the IRB number of IR.KUMS.REC.1400.424. All participants or their legal guardians were freely asked to sign a consent form to join this study before their enrollment after a clear explanation of the aims and methods of the study according to their knowledge. All the authors adhered to the 1975 Helsinki Declaration and its subsequent revisions.

The sample size of ~ 93 was calculated for each group with an alpha value of 0.05 and a beta value of 20%, but to ensure sample adequacy, 100 subjects were enrolled in each of the case and control groups [24]. The OLP diagnosis was based on the definition of OLP by the World Health Organization [25] and confirmed by pathology reports and clinical manifestations detected by an oral medicine specialist. Inclusion criteria for OLP patients were as follows: 1; diagnosis according to the definition of OLP by the World Health Organization 2; did not receive any relevant treatment before inclusion in this study [24]. The exclusion criteria were defined as any malignancy or autoimmune/inflammatory diseases and systemic disorders. Also, patients with amalgam lichenoid reaction lesions were excluded. A family history of OLP was not considered in the selection of subjects.

Genetic analysis

Three milliliters of saliva samples were collected from each subject in falcon tubes and immediately transferred to the laboratory on ice for storage at -80oC. Genomic DNA was extracted from the saliva samples using the standard (DNrich saliva kit, Cat. No. AESDX1010). Polymerase chain reaction with confronting two-pair primers (PCR-CTPP) technique (using two pairs of primers) was employed to determine the genotype and investigate the TNF-α-1031T/C polymorphism. PCR amplified TNF-a gene with the following primers:

F1: 5′ AAGGCTCTGAAAGCCAGCTG,

R1: 5′ CCAGACCCTGACTTTTCCTTCA,

F2: 5′ GAAGCAAAGGAGAAGCTGAGAAGAC,

R2: 5′ CTTCCATAG CCCTGGACATTCT [26].

The PCR parameters were: one cycle at 95 °C for 10 min, followed by 30 cycles of 95 °C for 1 min, 66 °C for 1 min, 72 °C for 1 min, and a final at 72 °C for 5 min.

Genotypes were identified based on the electrophoresis pattern on a 2% agarose gel.

In the obtained electrophoresis pattern, the CC genotype was represented by two bands of 174, 444 bp, the wild genotype (TT) was represented by two bands of 316 and 444 bp, and TC genotype was represented by three bands of 444, 316, and 174 bp (Fig. 1).

Fig. 1
figure 1

Electrophoresis pattern of PCR-CTPP products for TNF-α-1031 T/C genotypes. Lanes 1, 3, 5, and 8: sample with T/T genotype; Lanes 2 and 9: sample with C/C genotype; Lanes 4, 7, and 10: sample with T/C genotype. Lane 6 DNA size marker (50 bp). (See full, un-cropped version of this image on supplementary Figure S1)

Full size image

Statistical analysis

The frequency of genotypes under different genetic models and allele distribution between case and control groups were analyzed using the chi-square (χ2) test in Statistical Package for the Social Sciences version 16.0 (SPSS Inc. IBM, New York, USA). A logistic regression model was employed to evaluate the risk of TNF-α-1031 in OLP patients. Observed results were expressed as odds ratios (OR) with 95% confidence intervals. A p-value less than 0.05 was considered statistically significant.

Results

A total of 200 individuals participated in this study, comprising 100 patients (29 males and 71 females, mean age of 48 years) with OLP and 100 healthy controls(28 males and 72 females, mean age of 49 years) matched in terms of sex and age. The highest incidence of OLP was investigated in subjects aged 46–65 years (48%), followed in order of frequency among others aged 19–30 (9%), 31–45 (36%), and > 66 (7%). Also, 65% and 35% of the patients with OLP were diagnosed with clinical erosive and non-erosive subtypes, respectively. An analysis of genotype frequencies indicated no deviation from Hardy–Weinberg equilibrium in the patients (χ2 = 0.25, p = 0.88) and controls (χ2 = 0.026, p = 0.98).

The frequency of genotypes and allele − 1031-TNF-α among the studied groups have been shown in Table 1. The frequency of T/T, T/C, and C/C genotypes at position -1031 of TNF-α gene in the patient group were 55%, 37%, and 8%, respectively, and in the control group, they were 67%, 30%, and 3%, respectively. The frequency of 1031-TNF-α mutant genotype (CC) in the patient group was higher than compared to controls (8% and 3%, respectively). However, statistical analysis showed no significant differences in -1031-TNF-α genotypes between the control and patient groups (χ2 = 4.18, p = 0.12). Also, genotype frequencies in co-dominant, dominant over-, dominant, and recessive genetic models were not statistically different (p > 0.05). The genotype distributions were in Hardy-Weinberg equilibrium in OLP patients and the control group. The analyses revealed a statistically significant difference in allele frequencies between OLP patients and healthy controls (χ2 = 4.17, p = 0.042, 95% CI = 1.01–2.65, OR = 1.64). Our result indicates that the presence of the C allele significantly increases the risk of OLP (1.64-fold). Also, comparing genotype and allele frequencies of -1031-TNF-α between erosive and non-erosive clinical subtypes have been presented in Table 2. As indicated in Table 2, no significant association was observed between the TNF-α -1031 T/C allele and genotype in different genetic models with OLP severity (p > 0.05).

Table 1 Frequency distribution of SNP-1031 genotypes and related alleles of the TNF-α gene in OLP patients and control group
Full size table
Table 2 Frequencies of TNF-α gene, SNP-1031 in erosive and non-erosive subtypes
Full size table

Discussion

Cytokines are considered essential mediators for the development/pathogenesis of inflammatory diseases such as OLP. Regarding this issue, it has been shown that polymorphisms of cytokine genes such as IFN-γ, TNF-α, TNF-β, IL-4, IL-8, and IL-10 are associated with OLP susceptibility [27, 28]. Previously, we reported the genotype and allele frequencies of IL-8) + 781 C/T (in OLP patients among an Iranian population [29], indicating that IL-8 + 781 C/T polymorphisms might be correlated to the severity of OLP. TNF-α gene is a pro-inflammatory and immunomodulator cytokine playing a pivotal role in OLP pathogenesis. The expression of the TNF-α gene is regulated by various SNPs (-238, -244, -308, -376, -489, -575, -610, -851, -857, -863, -1031) in the promoter sequence, which consists of 1100 bp of DNA [30]. TNF-α -1031 polymorphism could be related to the up-regulation of TNF-α. Nourian et al. indicated a positive association between polymorphism of − 1031 T > C with the TNF-α mRNA expression level [31]. They demonstrated that the level of the TNF-α gene was higher expressed in genotype TT when compared with the other genotypes. According to our knowledge, this study is the first report on the association of -1031(T/C) polymorphism of the TNF-α gene (rs1799964) with the risk and severity of OLP disease in an Iranian population. Also, this is the first report for evaluating the SNP-1031 as one of the primary SNPs in the regulatory sequence of the TNF-α gene. The findings of this study demonstrated a positive association between TNF-α-1031 C/T allele distribution and the risk of OLP disease in the Iranian population. We collected saliva samples for DNA extraction because it is easy to access, non-invasive, and more practical for evaluation and analysis. Our study by previous reports confirmed that collecting saliva samples is a well-accepted procedure by all individuals [24, 32,33,34]. Mozaffari et al. reported elevated expression levels of TNF-α in saliva compared with serum samples [33]. They suggest that the measurement of TNF-α in saliva may be a more helpful marker for OLP diagnosis and treatment. Also, Zhang et al. concluded that saliva sampling could be an efficient substitute for serum collection in evaluating pro-inflammatory cytokines in patients with OLP [32]. Ghasemi et al. used saliva samples for genomic DNA extraction and genotyping of SNP IL-8 +781 [24].

Previous studies have demonstrated associations between TNF-α − 1031T/C polymorphism with different oral malignancies and autoimmune or inflammatory diseases such as Behçet’s disease [35], periodontitis [36], Crohn’s disease [37], chronic obstructive pulmonary disease [38], Gastric Carcinoma [39]. These findings suggest that the TNF-α gene may play a significant role in the susceptibility to inflammatory diseases. Majumder et al. concluded that − 1031T/C SNP of the TNF-α gene is associated with increased susceptibility to chronic periodontitis as a common inflammatory oral disease [36]. We concluded that the C allele of -1031 SNP of the TNF-α gene may increase the susceptibility to OLP disease. Our results are in accordance with Akman et al. findings, which showed that in the Turkish population, the TNF-α–1031 C allele is associated with susceptibility to Behçet’s disease [35]. Also, in agreement with our results, Sanchez et al. revealed a positive over-representation of homozygous −1031 CC among Crohn’s disease patients of Caucasians of the French-Canadian population.

A systematic review by Zhou and Vieira showed that G/A-308 polymorphism in TNF-α is a potential genetic marker for OLP [40]. Also, Al-mohaya et al. investigated the relationship between TNF-α, TNF-β, and interleukin ten gene polymorphisms in Saudi patients with the risk of OLP. They concluded that polymorphisms of TNF-α (-308G/A), TNF- β + 252 A/G, and IL-10 (-1082G/A, -819 C/T, and − 592 C/A) are associated with sensitivity to OLP [27]. Also, in a study by Kimkong et al., they evaluated the association of three polymorphisms in the promoter region of TNF-α, -863, -308, and − 238 in the Thai population of patients with OLP. In their study, no significant association with the development of OLP was found [41]. Carrozzo et al. analyzed thirteen cytokine genes with 22 single nucleotide polymorphisms. They suggested that the genetic polymorphism of the first intron of the IFN-c promoter gene may be an essential risk factor for developing OLP lesions. At the same time, the increased frequency of the TNF-α-308 allele may contribute to more skin involvement [42]. To our knowledge, this is the first report to study the TNF-α-1031 T/C polymorphism in OLP. As with any other study, this one is not without limitations. Among the limitations of this study were the small sample size of case and control subjects because of the limited available number of patients, lack of evaluation of TNF-α gene expression, and haplotyping with different SNPs.

Conclusion

The current study investigated the possible relationship between −1031(T/C) polymorphism of the TNF-α gene (rs1799964) and the risk and severity of OLP disease in an Iranian population. Our results indicated a non-significant higher frequency of mutant genotype (CC) in the OLP group compared to the control group. We found that the presence of the C allele significantly increased the risk of OLP disease by 1.64-fold. The results of this study demonstrate a positive association between TNF-α-1031 C/T allele distribution and the risk of OLP disease in the Iranian population for the first time. Therefore, our results support the genetic basis of OLP disease. The results of this study suggest that the -1031TNF-α C allele may be a genetic risk factor for OLP in the Iranian population. Therefore, the results of our study can support the genetic basis of OLP disease. However, further research is warranted to confirm these findings and to elucidate the mechanisms by which the -1031TNF-α C allele increases susceptibility to OLP. Additionally, studies with larger sample sizes in more expansive geographical areas and more detailed evaluations of TNF-α gene expression and haplotyping with different SNPs are necessary to gain a better understanding of the role of the -1031TNF-α C allele in OLP pathogenesis.

Data availability

All data generated or analyzed during this study are included in this published article.

Abbreviations

OLP:

Oral lichen planus

PCR-CTPP:

Polymerase chain reaction with confronting two-pair primers

TNF-α:

Tumor necrosis factor-alpha

IL:

Interleukin

SNP:

Single nucleotide polymorphism

References

  1. Eisen D, Carrozzo M, Bagan Sebastian JV, Thongprasom K. Number V oral lichen planus: clinical features and management. Oral Dis. 2005;11(6):338–49.

    Article  CAS  PubMed  Google Scholar 

  2. Deng X, Wang Y, Jiang L, Li J, Chen Q. Updates on immunological mechanistic insights and targeting of the oral lichen planus microenvironment. Front Immunol. 2022;13:1023213.

    Article  CAS  PubMed  Google Scholar 

  3. Olejnik M, Jenerowicz D, Adamski Z, Czarnecka-Operacz M, Dorocka-Bobkowska B. The prevalence of contact hypersensitivity in patients with oral lichen planus. Postepy Dermatol Alergol. 2022;39(4):668–74.

    Article  PubMed  Google Scholar 

  4. Scully C, Carrozzo M. Oral mucosal disease: Lichen Planus. Br J Oral Maxillofac Surg. 2008;46(1):15–21.

    Article  PubMed  Google Scholar 

  5. Pendyala G, Joshi S, Kalburge J, Joshi M, Tejnani A. Oral lichen planus: a report and review of an autoimmune-mediated condition in gingiva. Compend Contin Educ Dent. 2012;33(8):e102–8.

    PubMed  Google Scholar 

  6. Boorghani M, Gholizadeh N, Zenouz AT, Vatankhah M, Mehdipour M. Oral lichen planus: clinical features, etiology, treatment and management; a review of literature. J Dent Res Dent Clin Dent Prospects. 2010;4(1):3.

    PubMed  PubMed Central  Google Scholar 

  7. Mollaoglu N. Oral lichen planus: a review. Br J Oral Maxillofac Surg. 2000;38(4):370–7.

    Article  CAS  PubMed  Google Scholar 

  8. Sugerman PB, Sabage N. Oral lichen planus: causes, diagnosis and management. Aust Dent J. 2002;47(4):290–7.

    Article  CAS  PubMed  Google Scholar 

  9. Lodi G, Scully C, Carrozzo M, Griffiths M, Sugerman PB, Thongprasom K. Current controversies in oral lichen planus: report of an international consensus meeting. Part 1. Viral infections and etiopathogenesis. Oral surgery, oral medicine, oral Pathology. Oral Radiol Endodontology. 2005;100(1):40–51.

    Google Scholar 

  10. Sharma S, Saimbi C, Koirala B. Erosive oral lichen planus and its management: a case series. JNMA. 2008;47(170):86–90.

    CAS  Google Scholar 

  11. Rhodus NL, Cheng B, Myers S, Bowles W, Ho V, Ondrey F. A comparison of the pro-inflammatory, NF-κB-dependent cytokines: TNF-alpha, IL-1-alpha, IL-6, and IL-8 in different oral fluids from oral lichen planus patients. Clin Immunol. 2005;114(3):278–83.

    Article  CAS  PubMed  Google Scholar 

  12. Sun A, Wang J, Chia J, Chiang C. Serum interleukin-8 level is a more sensitive marker than serum interleukin‐6 level in monitoring the disease activity of oral lichen planus. Br J Dermatol. 2005;152(6):1187–92.

    Article  CAS  PubMed  Google Scholar 

  13. Mozaffari HR, Rahmani M, Rezaei F, Sadeghi M, Sharifi R, Ejtehadi A. Evaluation of oral lichen planus frequency in patients referred to pathology centers of Kermanshah city, during 2008 to 2011. Sch J App Med Sci. 2016;4(6E):2200–2.

    Article  Google Scholar 

  14. Ismail SB, Kumar SK, Zain RB. Oral lichen planus and lichenoid reactions: etiopathogenesis, diagnosis, management and malignant transformation. J Oral Sci. 2007;49(2):89–106.

    Article  PubMed  Google Scholar 

  15. Payeras MR, Cherubini K, Figueiredo MA, Salum FG. Oral lichen planus: focus on etiopathogenesis. Arch Oral Biol. 2013;58(9):1057–69.

    Article  CAS  PubMed  Google Scholar 

  16. Gupta S, Jawanda MK. Oral Lichen Planus: an update on etiology, Pathogenesis, clinical presentation, diagnosis and management. Indian J Dermatol. 2015;60(3):222–9.

    Article  PubMed  PubMed Central  Google Scholar 

  17. El-Howati A, Thornhill MH, Colley HE, Murdoch C. Immune mechanisms in oral lichen planus. Oral Dis. 2023;29(4):1400–15.

    Article  PubMed  Google Scholar 

  18. JA, NP, LA, F, TH. Vascular adhesion molecules in oral lichen planus. Oral Surg Oral Med Oral Pathol Oral Radiol Endodontology. 1996;81(6):682–90.

  19. Waldron-Lynch F, Adams C, Amos C, Zhu D, McDermott M, Shanahan F, et al. Tumour necrosis factor 5′ promoter single nucleotide polymorphisms influence susceptibility to rheumatoid arthritis (RA) in immunogenetically defined multiplex RA families. Genes & Immunity. 2001;2(2):82–7.

    Article  CAS  Google Scholar 

  20. Fu L, Lei C, Chen Y, Zhu R, Zhuang M, Dong L, et al. TNF-α-1031T/C gene polymorphism as a predictor of malnutrition in patients with gastric cancer. Front Nutr. 2023;10:1208375.

    Article  PubMed  PubMed Central  Google Scholar 

  21. Higuchi T, Seki N, Kamizono S, Yamada A, Kimura A, Kato H, et al. Polymorphism of the 5′-flanking region of the human tumor necrosis factor (TNF)‐α gene in Japanese. Tissue Antigens. 1998;51(6):605–12.

    Article  CAS  PubMed  Google Scholar 

  22. Chen Y-C, Liu S-F, Chin C-H, Wu C-C, Chen C-J, Chang H-W, et al. Association of tumor necrosis factor-α-863 C/A gene polymorphism with chronic obstructive pulmonary disease. Lung. 2010;188(4):339–47.

    Article  CAS  PubMed  Google Scholar 

  23. Sohail M, Kaul A, Bali P, Raziuddin M, Singh M, Singh O, et al. Alleles – 308A and – 1031 C in the TNF-α gene promoter do not increase the risk but associated with circulating levels of TNF-α and clinical features of vivax malaria in Indian patients. Mol Immunol. 2008;45(6):1682–92.

    Article  CAS  PubMed  Google Scholar 

  24. Ghasemi H, Mozaffari HR, Kohsari M, Hatami M, Yari K, Marabi MH. Association of interleukin-8 polymorphism (+ 781 C/T) with the risk of oral Lichen Planus disease. BMC Oral Health. 2023;23(1):404.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  25. Warnakulasuriya S, Kujan O, Aguirre-Urizar JM, Bagan JV, González-Moles M, Kerr AR, et al. Oral potentially malignant disorders: a consensus report from an international seminar on nomenclature and classification, convened by the WHO collaborating centre for oral Cancer. Oral Dis. 2021;27(8):1862–80.

    Article  PubMed  Google Scholar 

  26. Atsuta Y, Kawase H, Hamajima N, Nishio K, Niwa Y, Tanaka D, et al. Use of duplex PCR-CTPP methods for CYP2E1 RsaI/IL-2 T-330G and IL-1B C-31T/TNF-A T-1031 C polymorphisms. Mol Diagn. 2005;9(2):89–94.

    PubMed  Google Scholar 

  27. Al-Mohaya MA, Al-Harthi F, Arfin M, Al-Asmari A. TNF-α, TNF-β and IL-10 gene polymorphism and association with oral lichen planus risk in Saudi patients. J Appl Oral Sci. 2015;23:295–301.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  28. Lu R, Zhang J, Sun W, Du G, Zhou G. Inflammation-related cytokines in oral lichen planus: an overview. J Oral Pathol Med. 2015;44(1):1–14.

    Article  PubMed  Google Scholar 

  29. Ghasemi H, Mozaffari HR, Kohsari M, Hatami M, Yari K, Marabi MHJBOH. Association of interleukin-8 polymorphism (+ 781 C/T) with the risk of oral Lichen Planus disease. 2023;23(1):1–7.

  30. Yun JH, Choi JW, Lee KJ, Shin JS, Baek KH. The promoter – 1031(T/C) polymorphism in tumor necrosis factor-alpha associated with polycystic ovary syndrome. Reprod Biol Endocrinol. 2011;9:131.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  31. Nourian M, Chaleshi V, Pishkar L, Azimzadeh P, Baradaran Ghavami S, Balaii H, et al. Evaluation of tumor necrosis factor (TNF)-α mRNA expression level and the rs1799964 polymorphism of the TNF-α gene in peripheral mononuclear cells of patients with inflammatory bowel diseases. Biomed Rep. 2017;6(6):698–702.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  32. Zhang Y, Lin M, Zhang S, Wang Z, Jiang L, Shen J, et al. NF-κB-dependent cytokines in saliva and serum from patients with oral lichen planus: a study in an ethnic Chinese population. Cytokine. 2008;41(2):144–9.

    Article  CAS  PubMed  Google Scholar 

  33. Mozaffari HR, Ramezani M, Mahmoudiahmadabadi M, Omidpanah N, Sadeghi M. Salivary and serum levels of tumor necrosis factor-alpha in oral lichen planus: a systematic review and meta-analysis study. Oral Surg Oral Med Oral Pathol Oral Radiol. 2017;124(3):e183–e9.

    Article  PubMed  Google Scholar 

  34. Stasio DD, Mosca L, Lucchese A, Cave DD, Kawasaki H, Lombardi A, et al. Salivary mir-27b expression in oral Lichen Planus patients: a series of cases and a narrative review of literature. Curr Top Med Chem. 2019;19(31):2816–23.

    Article  PubMed  Google Scholar 

  35. Akman A, Sallakci N, Coskun M, Bacanli A, Yavuzer U, Alpsoy E, et al. TNF-alpha gene 1031 T/C polymorphism in Turkish patients with Behçet’s disease. Br J Dermatol. 2006;155(2):350–6.

    Article  CAS  PubMed  Google Scholar 

  36. Majumder P, Thou K, Bhattacharya M, Nair V, Ghosh S, Dey SK. Association of tumor necrosis factor-α (TNF-α) gene promoter polymorphisms with aggressive and chronic periodontitis in the eastern Indian population. Biosci Rep. 2018;38(4).

  37. Sanchez R, Levy E, Costea F, Sinnett D. IL-10 and TNF-alpha promoter haplotypes are associated with childhood Crohn’s disease location. World J Gastroenterol. 2009;15(30):3776–82.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  38. Gingo MR, Silveira LJ, Miller YE, Friedlander AL, Cosgrove GP, Chan ED, et al. Tumour necrosis factor gene polymorphisms are associated with COPD. Eur Respir J. 2008;31(5):1005–12.

    Article  CAS  PubMed  Google Scholar 

  39. Mohammed Azeez QA-n, Obaid Alwan ZH. The Association of-1031 T/C TNF-α gene promoter polymorphism with the incident of gastric carcinoma among Iraqi patients. J Appl Biotechnol Rep. 2022;9(2):645–50.

    CAS  Google Scholar 

  40. Zhou Y, Vieira AR. Association between TNFα-308 G/A polymorphism and oral lichen planus (OLP): a meta-analysis. J Appl Oral Sci. 2018;26.

  41. Kimkong I, Hirankarn N, Nakkuntod J, Kitkumthorn N. Tumour necrosis factor-alpha gene polymorphisms and susceptibility to oral lichen planus. Oral Dis. 2011;17(2):206–9.

    Article  CAS  PubMed  Google Scholar 

  42. Carrozzo M, Dametto E, Fasano ME, Arduino P, Broccoletti R, Vezza D, et al. Tumor necrosis factor-α and interferon-γ polymorphisms contribute to susceptibility to oral lichen planus. J Invest Dermatology. 2004;122(1):87–94.

    Article  CAS  Google Scholar 

Download references

Acknowledgements

Not applicable.

Funding

A grant (Grant No: 4000343) from the Office of Vice Chancellor for Research, Kermanshah University of Medical Sciences, Kermanshah, Iran, financially supported this work.

Author information

Authors and Affiliations

  1. Student Research Committee, School of Dentistry, Kermanshah University of Medical Sciences, Kermanshah, Iran

    Mohammad Hesam Marabi & Haniyeh Ghasemi

  2. Medical Biology Research Center, Health Technology Institute, Kermanshah University of Medical Sciences, Kermanshah, Iran

    Mohammad Hesam Marabi, Haniyeh Ghasemi & Kheirollah Yari

  3. Department of Oral and Maxillofacial Medicine, School of Dentistry, Kermanshah University of Medical Sciences, Kermanshah, Iran

    Hamid Reza Mozaffari & Masoud Hatami

Authors
  1. Mohammad Hesam Marabi
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Hamid Reza Mozaffari
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Haniyeh Ghasemi
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Masoud Hatami
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Kheirollah Yari
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

M.H. M. wrote the first draft of the manuscript, collected the samples, and performed experiments. K.Y. edited the final version of the manuscript. K.Y. and H.M. contributed to obtaining the funding and were responsible for experimental design, data collection, and analysis. M.H. and H.G. worked on the oral collection. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Kheirollah Yari.

Ethics declarations

Ethics approval and consent to participate

Ethics approval was obtained from the Ethics Committee of Kermanshah University of Medical Sciences (IR.KUMS.REC.1400.424). Written informed consent for participation was obtained from the informed consent has been obtained from all participants and their legal guardians. The Ethics Committee at Kermanshah University of Medical Sciences, Kermanshah, Iran, approved the current study.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1:

Supplementary figure S1 Full, un-cropped electrophoresis pattern of PCR-CTPP products for position -1031 of TNF-α gene shown in Figure 1

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Marabi, M.H., Mozaffari, H.R., Ghasemi, H. et al. Evaluation of the association between TNF-α-1031 T/C polymorphism with oral lichen planus disease. BMC Oral Health 24, 189 (2024). https://doi.org/10.1186/s12903-024-03939-x

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12903-024-03939-x

Keywords

BMC Oral Health

ISSN: 1472-6831

Contact us