Skip to main content
Download PDF

Antibacterial biofilm efficacy of calcium hydroxide loaded on Gum Arabic nanocarrier: an in-vitro study

BMC Oral Health volume 24, Article number: 215 (2024) Cite this article

Abstract

Background

An innovative intracanal medication formulation was introduced in the current study to improve the calcium hydroxide (Ca(OH)2) therapeutic capability against resistant Enterococcus faecalis (E. faecalis) biofilm. This in-vitro study aimed to prepare, characterize, and evaluate the antibacterial efficiency of Ca(OH)2 loaded on Gum Arabic (GA) nanocarrier (Ca(OH)2-GA NPs) and to compare this efficiency with conventional Ca(OH)2, Ca(OH)2 nanoparticles (NPs), GA, and GA NPs.

Materials and methods

The prepared nanoparticle formulations for the tested medications were characterized using Transmission Electron Microscope (TEM) and Fourier-Transform Infrared Spectroscopy (FTIR). 141 human mandibular premolars were selected, and their root canals were prepared. Twenty-one roots were then sectioned into 42 tooth slices. All prepared root canals (n = 120) and teeth slices (n = 42) were divided into six groups according to the intracanal medication used. E. faecalis was inoculated in the samples for 21 days to form biofilms, and then the corresponding medications were applied for 7 days. After medication application, the residual E. faecalis bacteria were assessed using CFU, Q-PCR, and SEM. Additionally, the effect of Ca(OH)2-GA NPs on E. faecalis biofilm genes (agg, ace, and efaA) was investigated using RT-PCR. Data were statistically analyzed at a 0.05 level of significance.

Results

The synthesis of NPs was confirmed using TEM. The results of the FTIR proved that the Ca(OH)2 was successfully encapsulated in the GA NPs. Ca(OH)2-GA NPs caused a significant reduction in the E. faecalis biofilm gene expression when compared to the control (p < 0.001). There were significant differences in the E. faecalis CFU mean count and CT mean values between the tested groups (p < 0.001) except between the Ca(OH)2 and GA CFU mean count. Ca(OH)2-GA NPs showed the least statistical E. faecalis mean count among other groups. SEM observation showed that E. faecalis biofilm was diminished in all treatment groups, especially in the Ca(OH)2-GA NPS group when compared to the control group.

Conclusions

Ca(OH)2 and GA nanoparticles demonstrate superior anti-E. faecalis activity when compared to their conventional counterparts. Ca(OH)2-GA NPs showed the best antibacterial efficacy in treating E. faecalis biofilm. The tested NP formulations could be considered as promising intracanal medications.

Peer Review reports

Introduction

A tooth with nonvital pulp is considered an ideal habitat for microbial infection. Unfortunately, endodontic infections are polymicrobial, predominantly anaerobic, with the presence of some facultative bacteria [1]. Enterococcus faecalis (E. faecalis) is a gram-positive facultative anaerobic bacterium. It is often isolated from failed root canal treatment due to its resistance to conventional antibacterial medicaments and harsh intracanal conditions [2,3,4]. Furthermore, E. faecalis can form biofilms, enhancing its growth and persistence [5]. The ability of E. faecalis to cause pulpal and periapical diseases, such as apical periodontitis, is also attributed to virulence genes responsible for biofilm formation and attachment to root dentine surfaces, factors that may intensify collagen adherence. Additionally, E. faecalis can create biofilms between the dentine wall and root canal filling without being affected during the non-surgical root canal retreatment procedures [6, 7].

Accordingly, several antibacterial agents were used to control resistant and persistent infections like E. faecalis, and among them was calcium hydroxide Ca(OH)2 [8, 9] It is frequently used as an intracanal medicament because it can inhibit bacterial enzymes and control bacterial growth. However, Ca(OH)2 has some drawbacks, such as the need for prolonged treatment duration and cytotoxicity. Furthermore, E. faecalis has shown resistance to calcium hydroxide in different studies [9,10,11,12].

Generally, antibacterial drugs’ potential to treat infections brought on by multidrug-resistant (MDR) pathogenic bacteria has been decreased, causing a public health issue [13]. Thus, research is being done on innovative methods to eradicate persistent MDR bacteria. Regarding biomedical applications, research on nanoparticles has been encouraged, suggesting a viable alternative therapy to traditional antibiotics. Studies have demonstrated that the antimicrobial activity of nano-sized Ca(OH)2 is superior to that of conventional Ca(OH)2. This was explained by their capacity to penetrate E. faecalis biofilms considerably [14, 15]. In nano-size (less than 100 nm measurement), they can also infiltrate into the dentinal tubules more deeply than the traditional form [15, 16]. Other Studies were done to prepare and estimate the antibacterial biofilm efficiency of different calcium hydroxide formulations. Ca(OH)2 was successfully loaded on various polymers, and it was discovered that these formulations could reduce bacteria more effectively than traditional medications [17,18,19,20].

There has been significant interest in using natural polymers like Collagen, Gelatin, Fibrin, Chitosan, and Alginate to produce medications with polymeric NPs [19,20,21]. Besides, natural polymers have shown the advantages of intrinsic biocompatibility and biodegradability when used as nanocarriers [22]. Gum Arabic (GA), one of the natural polymers, is non-toxic, water-soluble, and vastly used in the stabilization of the food and pharmaceutical industries [23]. Its structure contains charged amine and carboxyl groups that can physically adsorb into the nanoparticle surface when used as a stabilizer [24, 25].

Gum Arabic was used as an oral hygiene agent to inhibit bacterial pathogens due to its antimicrobial, anti-inflammatory, and fungicide properties [26]. It was also shown that the nano-sized formulation of GA could improve its antimicrobial properties [27]. The current study suggested creating a new intracanal medication formulation by using GA nanoparticles for Ca(OH)2 encapsulation to combine the benefits of both Ca(OH)2 and GA antibacterial properties. It is unclear whether GA, nano GA, or Ca(OH)2 loaded on GA nanocarrier, when used as intracanal medicaments, have better anti-E. faecalis biofilm efficiency than Ca(OH)2 or nano Ca(OH)2. Therefore, the primary objective of this study was to evaluate in vitro the antibiofilm effect of Ca(OH)2 loaded on GA nano carrier against E. faecalis bacterial biofilm in infected root canals. The secondary objective was to compare the antibiofilm effect of Ca (OH)2, nano Ca(OH)2, GA, nano GA, and Ca(OH)2 loaded on nano GA against E. faecalis bacteria. The null hypothesis was the absence of a significant difference between the tested intracanal medications regarding their anti-bacterial effect against E. faecalis. The alternative hypothesis was that there would be a significant difference in the antibacterial efficacy of Ca(OH)2 with or without loading it in the GA nanocarrier.

Materials and methods

The Preferred Reporting Items for Laboratory Studies in Endodontology (PRILE) 2021 standards [28] were followed when writing the paper for this laboratory study (Figure S1). This study was conducted with the approval of the Research Ethics Committee (REC) of the Faculty of Dentistry, Suez Canal University in Egypt (number 347/2021).

Preparation of different formulations of intracanal medications

All intracanal medications used in this study were manufactured by Nano-Gate company (Nasr city,11,765, Cairo, Egypt).

Preparation of calcium hydroxide nanoparticles (Ca(OH)2 NPs) powder

Ca(OH)2 nanoparticles were synthesized as per a previous study [29] using the ball mill technique. This involved milling conventional Ca(OH)2 powder (Loba Chemie, Mumbai, India) in a ball milling machine (planetary-ball-mill-pm-400, Retsch GmbH, Germany) for 10 h at a speed of 350 rpm with 3-minute intervals.

Preparation of nano Gum Arabic (GA NPs)

Gum Arabic nanoparticles were synthesized based on a method from a previous study [27] with some modifications. Briefly, GA (Sigma Aldrich Chemical Co., Gillingham, UK) was gradually added to a chitosan solution (CH, Primex ehf, Siglufjordur, Iceland) in a 4:1 weight ratio (GA:CH). Subsequently, sodium tri-polyphosphate (TPP; Sigma Aldrich Chemical Co., Gillingham, UK) was added in a 1:3 weight ratio relative to chitosan. The mixture was then stirred continuously for 2 h to obtain GA NPs, with chitosan serving as the stabilizing agent [30, 31].

Preparation of Ca (OH)2 loaded on GA NPs

Following the preparation of GA nanoparticles, Ca (OH)2 loaded on GA NPs was synthesized according to the previous studies [19, 27] by adding conventional calcium hydroxide (2.7 g) in the presence of GA NPs (2.7 g) with stirring for 30 min.

Preparation of Ca(OH)2, Ca(OH)2 NPs, GA, GA NPs, and Ca (OH)2 loaded on GA NPs in gel form

To prepare gel forms for each of Ca(OH)2, Ca(OH)2 NPs, GA, GA NPs, and Ca (OH)2 loaded on GA NPs, 2.7 g of each material was mixed with 10mL of sterile distilled water (4–8 °C). The mixture was sonicated and stirred (SCILOGEX, RockyHill, USA) for 1 h then, 0.5 g of Hydroxypropyl Methyl Cellulose (Sigma Aldrich Chemical Co., Gillingham, UK) was gradually added under mild temperature with vigorous stirring. The resultant mixture was then cooled (2–4 0C) to form a homogeneous gel.

Characterization of prepared intracanal medications

A Transmission Electron Microscope

(JEOL JEM-2100 high-resolution TEM, Tokyo, Japan), equipped with Selected Area Electron Diffraction (SAED) analysis was utilized to assess the size, shape, and distribution of the prepared nanoparticles (NPs). This analysis was conducted at an accelerating voltage of 200 kV, following the methodology described by Sharkawy et al. [27].

Fourier-Transform Infrared Spectroscopy

(FTIR, Shimadzu Europa, Duisburg, Germany) was employed to evaluate the compatibility of prepared medications. This was achieved by observing the functional groups involved in stabilizing the synthesized nanoparticles, as per the guidelines in references [30,31,32].

Evaluation of the effectiveness of the studied intracanal medications against E. faecalis biofilm (Fig. 1)

Fig. 1
figure 1

Schematic diagram showing the study design including the flow of teeth samples’ preparation (root canal model & teeth slices), sample size per each group (n), E. faecalis inoculation, medication placement, quantitative (CFU&Q-PCR) and qualitative (SEM) analysis

Full size image

Sample size calculation

The sample size used in the current study was calculated using G*Power software 3.1.9.6 (G Power; Franz Faul, University of Kiel, Germany) [33], and it was in accordance with a prior study [8].

  1. (A)

    Evaluation of antibiofilm efficiency of tested medicaments using Colony Forming Unit (CFU) and Quantitative Real-Time Polymerase Chain Reaction (Q-PCR) tests:

To assess the antibiofilm effectiveness of Ca(OH)2 loaded on GA nanocarrier and compare it with Ca(OH)2, Ca(OH)2 NPs, GA, GA NPs, and Hydroxypropyl Methyl Cellulose (control group) using CFU and Q-PCR analysis, repeated measures ANOVA was employed. The study was designed to detect a 0.20 effect size with a power of 90% (1-β = 0.90), at a significance level of p < 0.05 and a partial eta squared of 0.04. This required a minimum total sample size of 114. Based on these calculations, the study included six groups (A0, A1, A2, A3, A4, A5), with each group comprising at least 20 samples. These were further divided into two subgroups (n = 10) for different evaluation methods, with 10 specimens for PCR and 10 for CFU analysis. Therefore, the total sample size selected for the study was 120 specimens.

  1. (B)

    Evaluation of antibiofilm efficiency of tested medicaments using Scanning Electron Microscopy (SEM):

For evaluation of Ca (OH)2 loaded on GA nanocarrier antibiofilm efficiency and to compare its antibiofilm efficiency with Ca (OH)2, nano Ca (OH)2, GA, nano GA, and Hydroxypropyl Methyl Cellulose (control group) using SEM. The minimum total sample size was 30 (30 tooth slices from 15 teeth) to detect an effect size of 0.4 and 80% power (1-β = 0.80) at a partial eta squared of 0.14 at a significance of 0.05 significance. Based on these calculations, the study had six groups (A0, A1, A2, A3, A4, A5), each represented by at least 5 samples. An additional 12 samples (from 6 roots) were included, two for each group. One sample per group was used to verify sample sterilization before bacterial inoculation, and another to confirm biofilm formation by SEM prior to medication application. Thus, each group ultimately comprised 7 samples.

Selection of the teeth

A total of one hundred forty-one (n = 141) unidentified human mandibular premolars, freshly extracted for orthodontic reasons, were used in this study. Digital periapical radiographs were utilized for the preoperative assessment of these teeth, which were required to meet the following inclusion and exclusion criteria.

Inclusion criteria: Teeth had to be sound, single-rooted with a type I single canal (according to Vertucci’s classification [34]), and possess completely formed roots. Exclusion criteria: Teeth exhibiting external or internal root resorption, calcifications, hyper-cementosis, root canal variations, caries, or root fractures were excluded. The selected teeth were cleared of debris and calculus using an ultrasonic scaler (Miltex, Davies Drive, York) and then ultrasonically cleaned in distilled water for ten minutes. Teeth were subsequently immersed in 5.25% sodium hypochlorite (NaOCl, DEXA company for chemicals, Egypt) for 30 min to remove any soft tissue on the external root surface. This was followed by a final rinse with a 5% sodium thiosulfate solution (PIOCHEM, Egypt) to neutralize the sodium hypochlorite. Finally, the teeth were stored in normal sterile saline (0.9%) (Al Mottahedoon Pharma, Egypt) at room temperature until use.

Teeth samples preparation

Root canal preparation

All the included teeth (n = 141) were prepared as follows: A rotary diamond disk (Sharp Inc, Luzern, Switzerland) mounted on a low-speed handpiece with water coolant was used to decoronate the teeth just below the cementoenamel junction, standardizing the root length to15 mm. The working length was established by subtracting 1 mm from K file (Micro Mega, Besancon, France) size #15, ensuring it was visible at the apical foramen. Canal patency and working length for each tooth were verified radiographically using K files of sizes #10 and #15. Root canals were prepared using elephant rotary (Katowice, Poland) Ni-Ti system (torque = 2.5 N.cm, speed = 350 rpm) employing a step-down technique till the master apical file (MAF) reached #30 taper 4%, following the manufacturer’s instruction. Irrigation involved 3mL of 3% NaOCl (DEXA company for chemicals, Cairo, Egypt) for three minutes after each file, administered via a 3mL plastic syringe with 30-gauge side-vented needles (Laigues, Vd, Switzerland). To remove the smear layer, the canals were rinsed with 3mL of a 17% ethylenediaminetetraacetic acid (EDTA, Prevest Denpro Limited Company, Jammu, India) solution for five minutes, followed by rinsing with 10 mL of 10% distilled water and 5% sodium thiosulfate (PIOCHEM, Cairo, Egypt) respectively, to neutralize any remaining EDTA or sodium hypochlorite effect. Of the samples, 120 randomly selected root samples had their external surfaces dual-coated with nail polish, and the apices were sealed with a light-cured resin composite (Tetric, Ivoclar Vivadent, Schaan, Liechtenstein).

Teeth preparation for Scanning Electron Microscopic (SEM) evaluation

To evaluate the effectiveness of various intracanal medications against bacterial biofilm using SEM, the remaining 21 prepared roots (n = 21) were used. These roots were horizontally sectioned to remove the apical portion (9 mm), resulting in standardized root segments of six mm in length. Subsequently, the root segments were longitudinally divided into two halves to create 42 semi-circular root samples. This splitting was performed using a saw with a 0.3 mm blade thickness (Isomet 4000, Buehler Ltd., Lake Bluff, USA) at 1000 rpm, with underwater cooling for precision and to prevent heat damage.

Grouping of the teeth samples

All prepared root canals (n = 120) and teeth slices (n = 42) were divided into six groups according to the type of intracanal medication. Group A: Hydroxypropyl Methyl Cellulose (control), group B: Ca(OH)2, group C: nano Ca(OH)2, group D: Gum Arabic (GA), group E: nano GA and group F: Ca (OH)2 loaded on nano GA nanocarrier. Subsequently, each group was further divided into three subgroups according to different evaluation techniques. Ten root canal samples from each group were allocated for the colony forming unit test (CFU), another ten for the quantitative polymerase chain reaction test (Q-PCR), and seven teeth slices were used for SEM evaluation (Fig. 1).

Blind randomization of the prepared teeth samples

For blind randomization, each prepared root sample/slice was masked in an opaque envelope and coded by the allocator (resident dentist) using numerical identifiers (e.g., 1, 2, 3, 4, etc.). Similarly, the six syringes containing the tested intracanal medications were also masked and randomly assigned letter codes (A, B, C, D, E, F) by the allocator. Randomization of the samples was conducted using Microsoft Excel software. During the study, the operator selected the teeth sample and corresponding medicaments according to the predetermined randomization (e.g., 1-D,2-F) without knowledge of treatment type, Likewise, the evaluator was also blind to study groups, ensuring a double-blinded study design.

Preparation of Enterococcus faecalis bacteria

The standard E. faecalis bacterial strain used in this study was sourced from the American Type Culture Collection (ATCC #29,212). Bile esculin azide agar (BEA; Sigma-Aldrich, St Louis, MO) served as the selective medium to E. faecalis purification.

Biofilm formation capacity test

The Congo red agar assay (CRA), as described in a previous study [35], was employed to confirm the biofilm-forming capability of the selected E. faecalis strain. CRA was prepared and autoclaved then cooled, and aseptically poured into sterile glass petri plates (Sigma Aldrich Chemical Co., Gillingham, UK). Three plates were designated for the assay, onto, each of which 50 µL of E. faecalis culture (O.D. = 0.5) was streaked. The plates were at 37 °C overnight. The following day, the appearance of black colonies with dry, crystalline consistency was indicative of biofilm formation, while non-biofilm producers were identified by the growth of pink colonies.

Sterilization of the teeth samples and prepared medications

Each prepared root sample (n = 120) and slice (n = 42) was placed in a cryovial containing 500 µl of brain heart infusion (BHI; EL Nasr chemical co. Adwice, Egypt), and then autoclaved at 121 °C for 30 min to ensure sterilization. The sterilized teeth samples were vertically positioned in a sterile container specifically designed for this study, using a rubber base (Zeta Plus, condensation silicone, Zhermack, Rovigo, Italy) impression material for fixation. Additionally, the teeth slices were individually placed in a 96-well sterile microtiter plate (Sigma Aldrich Chemical Co., Gillingham, UK), one slice per well. These entire setups underwent a second autoclave cycle to guarantee sterility [36].

To confirm sterilization, different methods were employed. Samples incubated for 48 h at 37° C were randomly tested for sterility, using subcultures on blood agar. CFU and Q-PCR tests were conducted on randomly selected sterility samples (S0) using sterile absorbent paper points (size #30, taper 4%, Dentsply Maillefer, USA). Additionally, one tooth slice from each group (n = 6) was randomly chosen for SEM evaluation to further confirm sterilization. The prepared intracanal medicaments were sterilized before measuring antibacterial efficiency. The nanoparticles underwent γ-irradiation treatment, with a radiation dose of 25 kGy at a source temperature of 60 °C, in accordance with the European Pharmacopoeia [37].

Bacterial (E. faecalis) inoculation in root canals and teeth slices

E. faecalis bacteria were cultured and cultivated overnight at 37 °C in a brain heart infusion broth (BHI; EL Nasr chemical co. Adwice, Egypt) on a rotary shaker at 150 rpm. The microbial growth was monitored by observing changes in turbidity after 24 h. A standard volume of 15µL of E. faecalis culture (O.D = 0.5) was inoculated into each root canal (n = 120), while 7.5µL of the same culture (O.D. = 0.5) was inoculated into each tooth slice (n = 36), using an insulin syringe (AdvaCare, Cheyenne, USA). To facilitate biofilm formation and bacterial invasion into the dentinal tubules, the samples were cultured for an additional 21 days [38]. The BHI medium was replaced every three days with sterilized culture medium (BHI) to ensure the continued viability of the bacteria [39].

Conformation of biofilm formation at 21 days

Biofilm formation was quantitatively evaluated after 21 days for each group using Colony Forming Unit (CFU) and Q-PCR tests. Qualitative analysis was conducted using SEM evaluation. This was done to confirm that all samples had almost the same bacterial load before testing the intracanal medications. Any sample exhibiting extreme results was excluded and replaced with another to maintain consistency in the study.

Colony Forming Unit (CFU) assessment

Three sterile absorbent paper points (size #30; Dentsply Maillefer, USA) were employed to collect the microbiological samples (S1) from the root canals. Each paper point was inserted into the root canals for 60 s and gently pumped to collect the bacterial suspension from the main pulpal space. After collection, the paper points were placed into vials containing 0.25 mL of sterile saline solution. The vials were then vortexed for 15 s. Serial dilutions of samples were prepared, and 0.1 mL from each dilution was seeded onto bile Aesculin agar (Oxoid, Basingstoke, UK) plates. The plates were incubated at 37 °C for 24 h, after which the colonies were counted from the appropriate dilution and expressed as colony-forming units (CFU/mL).

Quantitative Polymerase Chain Reaction (Q-PCR) assessment

As previously described, microbiological samples (S1) were collected using three sterile absorbent paper points (size #30). These collected samples were then transferred into vials containing 0.25 mL of sterile saline solution. RNA isolation was performed in accordance with a prior study [40] utilizing the QIAamp RNeasy Mini kit (Qiagen, Hilden, Germany). Each sample, in a volume of 200 µl, was mixed with 600 µl of RLT buffer, which included 10 µl of β-mercaptoethanol per 1 mL. This mixture was then incubated at room temperature for 10 min. The lysate was combined with an equal volume of 70% ethanol, and the procedure followed the total RNA Purification protocol of the QIAamp RNeasy Mini kit.

For E. faecalis detection, species-specific oligonucleotide primers were used: 5’-GTT TAT GCC GCA TGG CAT AAGAG-3’ (forward primer) and 5’-CCG TCA GGG GAC GTT CAG-3’ (reverse primer). The Q-PCR reaction, with a total volume of 25 µl, included 10 µl of 2x HERA SYBR® Green RT-qPCR Master Mix (Willowfort, Birmingham, UK), 1 µl of RT Enzyme Mix (20 X), 0.5 µl of each primer at 20 pmol concentration, 5 µl of water, and 3 µl of RNA template. This reaction was conducted using a Q-PCR machine (Stratagene MX3005P, Agilent, Santa Clara, USA), and the Amplification curves and Cycle Threshold (CT) values were analyzed using AriaMx software (Agilent, Santa Clara, USA).

SEM qualitative evaluation

One tooth slice was randomly selected from each group (n = 6) for analysis. The selected slices were rinsed with sterile saline and then fixed in 2.5% glutaraldehyde for 2 h at 4 °C. Following fixation, the samples were washed again with sterile saline and dehydrated using a series of graded ethanol solutions. After dehydration, the samples were dried, gold-coated, and then imaged using a JEOL SEM (JSM 6510 lv, USA) at different magnifications (x1500, x3000) to inspect and validate the E. faecalis bacterial biofilm formation at various locations on each tooth slice.

Application of the tested medications in root samples

After 21 days, the samples were flushed using 5 mL of sterile water to remove the inoculated broth. Subsequently, the prepared root canals (n = 20) and remaining teeth slices (n = 5) in each group were treated with their respective intracanal medications. This was done using insulin syringes (AdvaCare, Cheyenne, USA), administering 0.4 mL for each root canal and 0.1 mL for each tooth slice. The groups of the treatments were as follows: group (A): Hydroxypropyl Methyl Cellulose (control samples), group (B): 27% w/v Ca (OH)2, group (C): 27% w/v nano Ca (OH)2, group (D): 27% w/v Gum Arabic (GA), group (E): 27% w/v nano GA, and group (F): Ca (OH)2 (27%) loaded on GA nanocarrier (27% w/v). After treatment, the roots were coronally sealed with a sterile Teflon pellet and capped with a temporary filling material (Coltosol F: Coltosol Whaledent, Altstatten, Switzerland), and then incubated at 37 °C. All procedures involving the tooth samples were performed under aseptic conditions in a laminar flow hood (Nuaire, Plymouth, MN, USA).

Antimicrobial assessment of E. faecalis biofilm in infected root samples and teeth slices after intracanal medications

After seven days of medication treatment under the previously described incubation conditions, the temporary filling material was removed. Each root canal and tooth slice were then rinsed with 5 mL of sterile saline (0.09%) to remove any remaining medications [41, 42], followed by an additional wash with 1 mL of 0.5% citric acid solution to neutralize the Ca(OH)2 effect. A final irrigation with 3 mL of sterile saline was performed [43]. The remaining bacteria were collected from each root canal sample by gently manually scraping the dentinal walls, 1 mm shorter than the working length (WL), using a K-file #30 (Micro Mega, Besancon, France) for 30 s. This process dislodged the attached biofilms and recovered viable bacteria from the root canal space and dentinal tubules. The intra-canal contents were then collected with paper points, as previously described. The collected paper points and K-file were placed in a vial containing 0.25 mL of sterile saline solution for quantitative evaluation of the bacterial count (S2) using CFU and Q-PCR.

The effect of Ca (OH)2 loaded on GA NPs as an intracanal medication on E. faecalis biofilm was additionally evaluated through the analysis of its effect on the genes responsible for biofilm formation (agg, ace, and efaA). The samples (S2) containing isolated RNA from Ca (OH)2 loaded on GA NPs treated root canals and untreated samples (control) were analyzed by Q-PCR test to quantify the expression of biofilm genes. Every sample was examined for endogenous (housekeeping Universal16S rRNA) gene: (forward, GACAGGAAAGAAACTAGGAGGAC, reverse, AAACAGACACATCGTGCT) and target biofilm genes (agggene: forward, TCTTGGACACGACCCATGAT reverse, AGAAAGAACATCACCACGAGC, acegene: forward, GAATGACCGAGAACGATGGC reverse, CTTGATGTTGGCCTGCTTCC & efaA gene: forward, GACAGACCCTCACGAATATG reverse, CCAGTTCATCATGCTGTAGTA) (Invitrogen, Thermo Fisher Scientific, Massachusetts, USA).

The Universal 16 S rRNA gene served as an internal control, and relative amplification efficiency of each gene in each test sample was calculated as follows: (Δ Ct control sample = Ct target gene – Ct endogenous, Δ Ct test sample = Ct target gene – Ct endogenous. The comparative value method was used to calculate the genetic material in each sample (Δ Δ Ct test sample = Δ Ct test sample – Δ Ct control). Then by using the 2- Δ Δ Ct(livak) method [44], the differential gene expression’s fold change (FC) in comparison to the control was computed. The Fold change indicates whether a gene is up-regulated or down-regulated.

Scanning Electron Microscope (SEM)

For observational comparison between the study groups, SEM was used to qualitatively evaluate the remaining bacterial biofilm on the teeth slices after treatment with different intracanal medications, as previously described. All the observational analyses for the SEM images were conducted blindly by three different examiners (2nd, 3rd, and 4th authors), each at different times.

Statistical analysis of the data

Data from Q-PCR and CFU tests were first assessed for normality using the Kolmogorov-Smirnov and Shapiro-Wilk tests. The data exhibited a parametric (normal) distribution, and were thus presented as mean and standard deviation (SD). One-way ANOVA followed by Tukey’s HSD test was used to compare more than two groups in unrelated samples. Also, an independent t-test was employed for comparisons between two groups (conventional-sized and nanosized GA and Ca (OH)2). Additionally, Two-way ANOVA was used to test to analyze the interaction between variables. The significance level was set at P ≤ 0.05, and all statistical analyses were performed using IBM SPSS Statistics Version 20 for Windows.

Results

Characterization of intracanal medications

Transmission Electron Microscope (TEM) analysis

As described in Fig. 2, TEM images of nano Ca (OH)2 showed spherical-shaped pours particles of average size (70.84 nm). Selected Area Electron Diffraction (SAED) showed a uniform nano Ca (OH)2 particle distribution. TEM images of Gum-Arabic nanoparticles were mostly spherical, and some oval particles were seen; the average size of the particles was (60.47 nm). The particles showed irregular distribution. Gum-Arabic Nanoparticles did not appear in SEAD as GA is an amorphous polymer. TEM images of Ca(OH)2 loaded on GA NPs showed the same amorphous profile oval-shaped particles of GA NPs in addition to the regular concentric distribution of Ca (OH)2 particles on the outer surface of GA -NPs of (60.47 nm) size as seen in SEAD.

Fig. 2
figure 2

Representative TEM images of the prepared intra-canal medication nanoparticles (NPs) (A&B: Ca(OH)2 NPs, C&D: GA NPs, E&F: Ca(OH)2 loaded on GA NPs at 100 and 200 nm Magnification, respectively) and SAED images for Ca(OH)2 NPs (G) and Ca(OH)2 loaded GA NPs (H)

Full size image

Fourier Transform Infrared Spectroscopy (FTIR) analysis

As described in Fig. 3, FTIR of nano Ca (OH)2 showed peaks at wavenumbers 1411.73 cm− 1 and 3639.87 cm-1, representing stretching, and bending vibration peaks of the O-H group of nano Ca (OH)2. Also, another peak at wavenumbers 873.46 cm− 1 corresponded to the symmetric deformation of the carbonate group.

FTIR spectrum of Ca(OH)2 showed sharp peaks at 3642 and 1407.43 cm− 1 wavenumbers corresponding to the stretching vibration of the O-H group. FTIR spectrum of nano GA showed peaks at 1635 cm− 1 and 3413.32 cm-1 wavenumbers related to the asymmetrical extensional vibration of a carboxyl group and extension of the O-H group, respectively. FTIR spectrum of Ca(OH)2 loaded on GA-NPs showed Peaks at 1635 cm− 1 and 3413.32 cm-1 wavenumbers, similar to the GA-NPs spectrum. Furthermore, no obvious sharp peaks associated with the free drug were detected. These results indicated that neither change in the main backbone of GA NPs polymer structure nor the formation of new bonds between Ca(OH)2 and GA-NPs had occurred, referencing a full encapsulation of the Ca(OH)2 in the GA-NPs [17, 20].

Fig. 3
figure 3

Representative images for FTIR chart of (A) calcium hydroxide NPs and (B) conventional calcium hydroxide, GA NPs, and calcium hydroxide loaded GA NPs

Full size image

Biofilm formation capacity of E. faecalis

Biofilm growth of all E. faecalis on the Congo red plate caused blacking of the medium due to the production of exopolysaccharides (EPS), the major constituent of biofilm confirmed biofilm formation, and the plate free from E. faecalis remained pink, indicating no biofilm formation (Figure S2). Also, the Scanning Electron Microscopic (SEM) evaluation (Fig. 4) showed the sterilization of root samples before bacterial inoculation, and the formation of E. faecalis biofilm on the surface of root canals after E. faecalis inoculation was validated in the random samples.

Fig. 4
figure 4

Representative SEM images for the study samples teeth slices; A&B: after samples sterilization (n = 1 in each group) and before the E. faecalis inoculation, C&D: after E. faecalis inoculation and biofilm formation (n = 1 in each group) at different magnifications (1.500X &3000X)

Full size image

The effect of tested intracanal medications on E. faecalis bacteria

All preoperative samples (S1) showed almost the same count, and no sample was excluded from the study.

Colony Forming Unit (CFU) assessment

Total bacterial counts (Log10 CFU/mL) presented as mean and standard deviation were listed in (Supplementary Tables 1,2) and (Fig. 5). The six studied groups showed high statistically significant differences in CFU mean count (p < 0.001) except (Ca(OH)2, GA groups) and (nano Ca(OH)2 and nano GA groups) showed no significant difference with each other. The lowest significant mean total bacterial count was recorded in Ca (OH)2 loaded on the GA NPs group (2.20 ± 0.22 CFU/mL). In contrast, the highest significant total bacterial count was recorded in the control group (8.70 ± 0.22 CFU/mL). The Two-way analysis of variance showed an overall highly significant effect (p < 0.001). Moreover, there was a highly significant effect induced by Ca (OH)2, GA (p < 0.001) in NPs formulations when compared to their conventional form (p < 0.001).

Fig. 5
figure 5

Bar charts representing the assessment of antibiofilm efficacy of the tested intracanal medications, (A) bars showing Mean ± SD values for (Log10 CFU/mL) of E. faecalis bacteria recovered after tested intracanal medication treatments (n = 10 in each group), (B) bars showing Mean ± SD values for CT of E. faecalis bacteria recovered after tested intracanal medication treatments (n = 10 in each group). Means followed by different letters are significantly different according to Tukey’s HSD

Full size image

Quantitative Polymerase Chain Reaction (Q-PCR) assessment

According to the results of the Q-PCR melting curve (Figure S3), the six studied groups showed high statistically significant differences in the resulting Cycle Threshold (CT) values (p < 0.001***) (Supplementary Tables 3,4) (Fig. 5). The lowest significant mean CT value was recorded in the control group (17.12 ± 0.61) (denoting the highest bacterial count). While the highest significant mean CT value was recorded in Ca (OH)2 loaded on the GA NPs group (31.80 ± 0.64) (denoting the lowest bacterial count). The Ca (OH)2 and Ca(OH)2 NPs revealed more significant CT values than GA and GA NPs, respectively. Two-way analysis of variance showed an overall highly significant effect (p < 0.001). Moreover, a highly significant effect was induced by Ca(OH)2 and GA in NPs formulations (p < 0.001) when compared to their conventional forms.

Evaluation of the effect of Ca(OH)2 loaded on GA NPs on E. faecalis biofilm genes expression

The relative Q-PCR results showed that the mean threshold cycle (CT) values of two examined gene products (ace and efaA) were significantly higher in the Ca(OH)2 loaded on GA NPs treated samples when compared to the untreated control samples. The resultant mean fold change (FC) for the three tested genes was upregulated (1 ± 0) in the untreated samples, meaning these genes were more expressed. While the mean fold change for Agg (0 ± 10), ace (0 ± 0), and efa A (0 ± 0) genes in the treated samples were downregulated, that means that these genes were less expressed. Statistical data also showed that the fold changes (FC) in the three tested genes’ expression were highly significant (p < 0.001) in the treated samples when compared to the control sample (Table 1).

Table 1 Showing Mean ± SD values fold changes in expression of biofilm genes (ace, agg, and efaA) of E. faecalis in the control and Ca(OH)2 loaded on GA NPs treated samples
Full size table

Scanning Electron Microscope (SEM)

Regarding the observation analysis for the effect of different intracanal medications on E. faecalis biofilm, the biofilm of E. faecalis was diminished in all treatment groups except for the control. Moreover, the Ca (OH)2 loaded on GA showed greater bacterial reduction than other groups (Fig. 6).

Fig. 6
figure 6

Representative SEM images for E. faecalis bacteria response to different intracanal medicament tested (n = 5 in each group) A: Control (Hydroxypropyl Methyl Cellulose). B: Ca (OH)2 medication effect, C: GA medication effect, D: nano Ca (OH)2 medication effect, E: nano GA medication effect, and F: Ca (OH)2 loaded on GA NPs medication effect under (x 3000) magnification of SEM. Note that all treatments showed a reduction of bacteria compared to the control one

Full size image

Discussion

Resistant and persistent bacteria after chemo-mechanical preparation inside the root canal system is considered an endodontic nightmare. The presence of complex root canal anatomy acts as a favorable shelter for the growth of E. faecalis bacteria [2,3,4]. The small size of E. faecalis enables it to rapidly invade and colonize inside dentinal tubules, isthmi, ramifications, or recesses and hide from conventional medications [45]. Despite the excellent properties of Ca(OH)2 as an intracanal medication, it was reported to have certain weaknesses against E. faecalis [46,47,48]. To solve the challenges stated above, various disinfection protocols have been proposed to increase the success rate of root canal treatment.

Because of the improved antimicrobial effect of medicaments in nanoparticles [14,15,16], studies have suggested either their combination with conventional medicaments or using nanoparticles as a carrier for intracanal medicaments delivery [49]. The recent world trend is directed toward medication encapsulated into natural polymeric nanocarriers because of their intrinsic biocompatibility, biodegradability, and higher antibacterial activity [22, 50,51,52,53,54]. Accordingly, the current in-vitro study used the developments in nanotechnology and natural polymer synthesis to introduce Ca(OH)2 loaded on GA nanocarrier as a new intracanal medication formulation.

The new nanoparticle formulation was characterized using TEM to evaluate the size, shape, and distribution of prepared NPs. Fourier-transform infrared Spectroscopy (FTIR) was done to evaluate the compatibility of prepared medications by observing functional groups involved in stabilizing synthesized nanoparticles [20, 55]. The absence of peaks indicative of free Ca(OH)2 in the Ca(OH)2 loaded GA nanocarrier indicated that it was not a mixture of both Ca(OH)2 and GA in the same sample [17]. Instead, Ca(OH)2 was successfully encapsulated inside the GA nanocarrier particles. This encapsulation was important to ensure that the pharmacokinetics of loaded Ca(OH)2 were not affected and that no formation of new compounds with unknown biological behavior had occurred [17, 20].

It was important in the current study to evaluate whether the newly introduced intracanal medication formulation could give more anti-E. faecalis biofilm efficacy compared to the other tested medications, including the conventionally used calcium hydroxide or not. No previous study was found to assess the antibacterial efficacy of Ca(OH)2 and GA comparatively, either in their conventional or nanoparticle size. Therefore, the Ca(OH)2 loaded on GA nanocarrier, GA, nano GA, Ca(OH)2, and nano Ca(OH)2 antimicrobial efficacy against mature E. faecalis biofilm inside infected root canals was also compared.

An in vitro endodontic infection model using E. faecalis standard strain collection (ATCC #29,212) was used in the current study, as this bacterium was found to be most commonly associated with failed root canal treatment [56]. Also, most disinfection studies used E. faecalis in evaluating the antibacterial efficiency of different intracanal medications. So, as the current study used new intracanal medication formulations, we could compare the results with the previous studies [36, 57].

To get predictable outcomes in this study, different laboratory models of dentinal tubule infection and evaluation tools for the antibacterial effect of the tested intracanal medications on E. faecalis biofilm were used [57]. According to previous endodontic disinfection studies, the root canal model was used to closely mimic the clinical conditions [36, 57]. SEM evaluation was also used in different studies to monitor E. faecalis properties, including its aggregation, invasion into dentinal tubules, and biofilm morphological and structural characterization [2, 36, 57]. Since the SEM visualization of the formed biofilm could not be done for the root canal model without root sectioning, that could detach and affect the formed biofilm structure. So, in the current study, additional separate tooth slice models were prepared for observational analysis of bacterial reduction in response to different tested medications using high-resolution SEM images [57].

The coronal part of root dentine was used to prepare standardized tooth slices because it has a more uniform and greater diameter of dentinal tubules (4.32 μm) with less inter-tubular dentine than in the apical zone (1.73 μm) [55, 58]. This allows more area for bacterial invasion during inoculation and better inspection using SEM analysis. In contrast, the apical dentine has marked structural variations, including irregular dentinal tubules in both direction and density, varied amounts of irregular secondary dentine (areas might be devoid of tubules), accessory root canals, areas of resorption, pulp stones, and even cementum-like tissue lining the apical root canal wall [59, 60].

Previously, it was shown that, the biofilm of refractory endodontic infections, including E.faecalis biofilm, survived under nutritionally stressful environmental conditions inside the root canals. This possibly renders them resistant to the chemo-mechanical disinfecting procedures [61, 62]. Thus, in the current study, to mimic this clinical condition, the frequency of refreshing the culture medium was limited to three-day intervals instead of daily medium change as a way to increase the bacterial biofilm resistance to antimicrobial treatments [39, 57, 62].

For quantitative evaluation, CFU was used as a simple method for counting bacteria, but it could only discover bacteria that could start cell division at a rate fast enough to establish colonies. To overcome these drawbacks, Q-PCR was also used to compare the antibiofilm efficiency of different medications due to its ability to identify and quantify one or more particular sequences in a gene sample [63]. Q- PCR relies on DNA’s enzymatic replication and thermal cycling. Consequently, estimating the amount of target gene copies in a sample has been utilized to estimate and compute bacterial aggregations in biofilms. Compared to traditional PCR, Q-PCR was reported to be more accurate and sensitive [57, 63]. Besides, to focus on the antibiofilm efficacy of the newly formulated Ca(OH)2 loaded on GA NPs medication, its effect on the expression of biofilm-forming genes (ace, agg, and efaA) using relative Q-PCR was also analyzed.

The colonization of dental root surfaces by E. faecalis is enhanced by the expression of adhesion factors (like ace and agg genes) through increasing their adhesion to dentinal collagen [64]. The ace gene was shown to enhance the adherence of E. faecalis to human collagen type IV and human dentine [65]. Besides, the aggregation genes have been shown to promote E.faecalis adhesion to the host cell through extracellular matrix protein adherence and elevated cell surface hydrophobicity. It was found that the E.faecalis that encoded the agg gene resisted phagocytosis by inhibiting the respiratory burst in macrophages, which results in the generation of reactive oxygen species (ROS) [66]. Also, the growth of E. faecalis in serum-containing media has been shown to promote the expression of endocarditis virulence factor (efaA). Since cardiac and dentinal tissues both contain the same proteins, efaA has been shown to improve the attachment of E. faecalis to collagen and extracellular matrix in root canal infections [67,68,69].

In the current study, the null hypothesis was partially rejected. All the tested medications demonstrated a significant antimicrobial effect against E. faecalis compared to the control (untreated samples). Ca(OH)2 and Ca(OH)2 NPs showed comparable antibacterial effects to GA and GA NPs, respectively, when the CFU test was used. On the other hand, when using the Q-PCR test, there were significant differences between all the tested intracanal medications regarding their antibacterial efficacy. The difference in the Q-PCR and CFU test results emphasizes the importance and sensitivity of the molecular methods in determining the bacterial count [57].

Ca(OH)2 and its NPs showed a greater anti-E. faecalis effect than GA and its NPs. In the literature, there were contradictory results about the sensitivity of E. faecalis to Ca(OH)2 [10,11,12, 70,71,72,73,74,75]. Some studies [9, 71,72,73] agreed with the current results and supported the presence of Ca(OH)2 antibacterial effect against E. faecalis. It was demonstrated that most microorganisms could not survive in excessively alkaline environments like that of Ca(OH)2 (12.5–12.8) [76]. Ca (OH)2, when contacted with an aqueous solution, breaks down into calcium and hydroxyl ions. These ions cause the major antibacterial actions of Ca(OH)2 on vital tissues [9].

On the other hand, other studies showed a reduced Ca(OH)2 antibacterial effect against E. faecalis when compared to other antibacterial agents (like Liquorice extract, Propolis, and triple antibiotic mixture) [10, 12, 74]. Also, a prominent resistance of E. faecalis against Ca(OH)2 was reported to be due to their proton pump activity [70, 75], which causes the environment to become acidic, and its biofilm-forming ability. Recently, it was also shown that Ca(OH)2 could help in E. faecalis’s biofilm calcification [48]. These factors enable E. faecalis to overcome the high pH levels of Ca(OH)2, augmented by the dentine buffering action [46, 47]. The contradiction in the results between studies might also be due to the variation in bacterial organization within the biofilm’s extracellular polymeric substance (EPS) and different biofilm substrates used that significantly impacted the Ca(OH)2 antibacterial efficiency.

The resulting GA antibacterial effect in the current study was in accordance with previous studies [23, 26, 77,78,79,80,81] and was attributed to its great salt composition of Ca+ 2, Mg+ 2, and K+ 2 of polysaccharides and its efficacy in the metabolism of Ca and possibly phosphate [77, 78]. Also, numerous types of enzymes like peroxidases, oxidases, and pectinases were found in the GA composition, some of which have antibacterial effects [79]. The antibacterial efficacy of GA has been additionally linked to their secondary metabolites or the presence of flavonoids, alkaloids, phenol, volatile oil, saponin, saponin glycosides, triterpenoid, and hydrolyzable tannin [80, 81].

Both tested materials (Ca (OH)2 and GA) nanoparticles in the current study had better antibacterial and antibiofilm efficiency than their conventional form. Similarly, other studies have shown that using Ca(OH)2-NPs could effectively penetrate the dentinal tubules deeper than conventional Ca (OH)2, causing greater efficacy in the E. faecalis biofilm eradication from dentinal tubules [14,15,16]. The higher antibacterial efficiency might be attributed to the change in the physiochemical properties of the materials when they are prepared in nanosized [82]. Since the nanoparticles have more chemical and biological reactivity than their conventional counterparts [49], they could interact with negatively charged bacterial cells more due to their larger surface area and higher charge density [50].

In the present study, Ca(OH)2 was loaded on GA NPs as a nanocarrier, aiming to increase the antibacterial efficiency of Ca(OH)2. Fortunately, this new formulation showed the greatest antibiofilm efficiency in comparison to all other tested medications in all the tests used in the current study (CFU, Q-PCR, SEM). This was in agreement with previous studies that revealed that combining calcium hydroxide with silver nanoparticles or zinc oxide nanoparticles was more effective in eliminating E. faecalis from infected dentine than conventional Ca(OH)2 alone [50, 83, 84]. Nagarathinama et al. [55], in their study loaded the triple antibiotic past on apatitic nanocarriers (TAAN) and showed significantly higher antibacterial biofilm against E. faecalis than conventional TAP. In another study by Arafa et al. [85], ciprofloxacin (CIP) was loaded on PLGA nanoparticles and showed significantly higher antibacterial biofilm against E. faecalis than conventional ciprofloxacin. On the contrary, Farhadian et al. [17] found that the E. faecalis inhibition zones around Gum Tragacanth polymer, Ca(OH)2 and Ca(OH)2 encapsulated with Gum Tragacanth disks were similar when agar disc diffusion method was used.

The significant decrease in the biofilm-forming genes (ace, agg, and efaA) detected by relative Q-PCR when E. faecalis was treated with Ca (OH)2 loaded on GA NPs compared with the untreated sample (control) was in agreement with a previous study [86]. This study showed that using chitosan-propolis nanoparticles in biofilm eradication increases the antibacterial efficiency by altering the expression of E. faecalis biofilm-associated genes [86].

The increased antibacterial effect of Ca (OH)2 loaded on GA NPs in the current study was probably due to favorable hygroscopic compatibility, attracting electrostatic force and synergism between GA NPs polymeric matrix and Ca (OH)2. Additionally, it could be explained by the NPs’ lesser size (below 200 nm) than the dentinal tubules’ diameter, which ranges from 2400 to 4280 nm [87]. So, it could be predicted that Ca(OH)2 and GA medicines would be delivered deeper into the dentinal tubules and biofilm. Thus avoiding the dentinal tubules’ buffering action and increasing their antibacterial effect [20, 51]. Similarly, a previous study [20] showed a marked greater Ca(OH)2 depth and area of penetration into dentinal specimens when loaded into poly lactic-co-glycolic acid (PLGA) nanocarrier, in comparison to conventional Ca (OH)2. Furthermore, it was shown previously that nanocarriers could deliver high drug concentrations for a long time [52]. Thus, the sustained Ca(OH)2 release by GA nanocarrier could be another reason for increasing its efficiency in invading biofilm [17, 19, 51].

Despite the promising results from CFU, Q-PCR, and SEM tests regarding the new intracanal medicament formulation in the current study, testing E. faecalis virulence genes in response to the other tested medications is suggested in further studies. Additional cytotoxicity evaluation for the tested medications in the current study is highly recommended to achieve a more decisive conclusion regarding this new formulation.

Another limitation is that this study was done in vitro, using only one type of bacteria in the endodontic infection model. This did not reflect the in-vivo conditions, including the synergism between different bacterial types, buffering oral environment, and the bacterial phenotype diversity in the endodontic infection. Testing the antibacterial effect of these medications, including a wider range of intra-canal microorganisms, using more advanced molecular identification methods like next-generation sequencing is recommended. Thus, the current study could reveal promising results for Ca (OH)2 loaded on GA NPs formulation, suggesting new root canal disinfection protocols, especially in regenerative endodontics. However, this formulation requires more research representing the clinical state in further in-vivo studies.

Conclusions

Within the limitations of the present study, it is concluded that the Ca(OH)2 NPs and GA NPs have superior antimicrobial and antibiofilm activity against E. faecalis compared to conventional Ca (OH)2 and GA. Furthermore, Ca(OH)2 loaded on GA-NPs showed the best antimicrobial and antibiofilm efficacy in treating E. faecalis biofilm-infected root canals and it could be considered a promising intracanal medication instead of conventional Ca(OH)2.

Data availability

The datasets generated and/or analyzed during the current study are not publicly available due to privacy but are available from the corresponding author upon reasonable request.

Abbreviations

Ca(OH)2 :

Calcium hydroxide

GA:

Gum Arabic

NPs:

Nano-particles

REC:

Research Ethics Committee

TEM:

Transmission Electron Microscope

FTIR:

Fourier-Transform Infrared Spectroscopy

CFU:

Colony Forming Unit

Q-PCR:

Quantitative Polymerase Chain Reaction

SEM:

Scanning Electron Microscope

CT:

Cycle Threshold

EDTA:

Ethylenediaminetetraacetic acid

NaOCl:

Sodium hypochlorite

References

  1. Narayanan L, Vaishnavi C. Endodontic microbiology. J Conserv Dent. 2010;13:233–9.

    Article  PubMed  PubMed Central  Google Scholar 

  2. Kak V, Chow JW. Acquired antibiotic resistances in enterococci. In: Gilmore M, Clewell D, Courvalin P, Dunny G, Murray B, Rice L, editors. Enterococci: pathogenesis, molecular biology, and antibiotic resistance, Chap. 9, Washington: ASM Press. Society for General Microbiology, Neil Woodford, Antibiotic Resistance Monitoring & Reference Laboratory, CPHL, London.; 2002. p. 440.

    Google Scholar 

  3. Rôças IN, Siqueira JF Jr, Santos KR. Association of Enterococcus faecalis with different forms of periradicular diseases. J Endod. 2004;30(5):315–20.

    Article  PubMed  Google Scholar 

  4. Tendolkar PM, Baghdayan AS, Shankar N. Pathogenic enterococci: new developments in the 21st century. Cell Mol Life Sci. 2003;60(12):2622–36.

    Article  CAS  PubMed  Google Scholar 

  5. Ramsey M, Hartke A, Huycke M. The physiology and metabolism of Enterococci. In: Gilmore MS, Clewell DB, Ike Y, Shankar N, editors. Enterococci: from commensals to leading causes of drug resistant infection. Boston: Massachusetts Eye and Ear Infirmary; February 15, 2014.

  6. Nallapareddy SR, Singh KV, Duh RW, Weinstock GM, Murray BE. Diversity of ace, a gene encoding a microbial surface component recognizing adhesive matrix molecules, from different strains of Enterococcus faecalis and evidence for production of ace during human infections. Infect Immun. 2000;68(9):5210–7.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  7. Stevens RH, Porras OD, Delisle AL. Bacteriophages induced from lysogenic root canal isolates of Enterococcus faecalis. Oral Microbiol Immunol. 2009;24(4):278–84.

    Article  CAS  PubMed  Google Scholar 

  8. Al Shahrani M, DiVito E, Hughes CV, Nathanson D, Huang GT. Enhanced removal of Enterococcus faecalis biofilms in the root canal using sodium hypochlorite plus photon-induced photoacoustic streaming: an in vitro study. Photomed Laser Surg. 2014;32(5):260–6.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  9. Farhad A, Mohammadi Z. Calcium hydroxide: a review. Int Dent J. 2005;55(5):293–301.

    Article  PubMed  Google Scholar 

  10. Badr AE, Omar N, Badria FA. A laboratory evaluation of the antibacterial and cytotoxic effect of Liquorice when used as root canal medicament. Int Endod J. 2011;44(1):51–8.

    Article  CAS  PubMed  Google Scholar 

  11. Panzarini SR, Trevisan CL, Brandini DA, et al. Intracanal dressing and root canal filling materials in tooth replantation: a literature review. Dent Traumatol. 2012;28(1):42–8.

    Article  CAS  PubMed  Google Scholar 

  12. Mattigatti S, Ratnakar P, Moturi S, Varma S, Rairam S. Antimicrobial effect of conventional root canal medicaments vs propolis against Enterococcus faecalis, Staphylococcus aureus and Candida albicans. J Contemp Dent Pract. 2012;13(3):305–9.

    Article  PubMed  Google Scholar 

  13. Fard RM, Barton MD, Arthur JL, Heuzenroeder MW. Whole-genome sequencing and gene mapping of a newly isolated lytic enterococcal bacteriophage EFRM31. Arch Virol. 2010;155(11):1887–91.

    Article  CAS  PubMed  Google Scholar 

  14. Dianat O, Saedi S, Kazem M, Alam M. Antimicrobial activity of nanoparticle calcium hydroxide against enterococcus faecalis: an in Vitro Study. Iran Endod J. 2015;10(1):39–43.

    CAS  PubMed  Google Scholar 

  15. Zand V, Mokhtari H, Hasani A, Jabbari G. Comparison of the penetration depth of conventional and nano-particle calcium hydroxide into dentinal tubules. Iran Endod J. 2017;12(3):366–70.

    CAS  PubMed  PubMed Central  Google Scholar 

  16. Sireesha A, Jayasree R, Vidhya S, Mahalaxmi S, Sujatha V, Kumar TSS. Comparative evaluation of micron- and nano-sized intracanal medicaments on penetration and fracture resistance of root dentin - an in vitro study. Int J Biol Macromol. 2017;104(Pt B):1866–73.

    Article  CAS  PubMed  Google Scholar 

  17. Farhadian N, Godiny M, Mansouri A, Moradi S, Tajehmiri A, Shahlaei M. Hydrophilic natural polymers for sustained-controlled release of calcium hydroxide. Iran J Pharm Res. 2020;19(2):323–32.

    CAS  PubMed  PubMed Central  Google Scholar 

  18. Han B, Wang X, Liu J, et al. The biological performance of calcium hydroxide-loaded microcapsules. J Endod. 2013;39(8):1030–4.

    Article  PubMed  Google Scholar 

  19. Farhadian N, Godiny M, Moradi S, Hemati Azandaryani A, Shahlaei M. Chitosan/gelatin as a new nano-carrier system for calcium hydroxide delivery in endodontic applications: development, characterization and process optimization. Mater Sci Eng C Mater Biol Appl. 2018;92:540–6.

    Article  CAS  PubMed  Google Scholar 

  20. Elmsmari F, González Sánchez JA, Duran-Sindreu F, et al. Calcium hydroxide-loaded PLGA biodegradable nanoparticles as an intracanal medicament. Int Endod J. 2021;54(11):2086–98.

    Article  PubMed  Google Scholar 

  21. Lee J, Yun H. Hydroxyapatite-containing gelatin/chitosan microspheres for controlled release of lysozyme and enhanced cytocompatibility. J Mater chem B. 2014;2(9):1255–63.

    Article  CAS  PubMed  Google Scholar 

  22. Kannan R, Rahing V, Cutler C, et al. Nanocompatible chemistry toward fabrication of target-specific gold nanoparticles. J Am Chem Soc. 2006;128(35):11342–3.

    Article  CAS  PubMed  Google Scholar 

  23. Li J, Xu X, Chen Z, et al. Zein/gum arabic nanoparticle-stabilized Pickering emulsion with thymol as an antibacterial delivery system. Carbohydr Polym. 2018;200:416–26.

    Article  CAS  PubMed  Google Scholar 

  24. Jayme M, Dunstan D, Gee M. Zeta potentials of gum arabic stabilised oil in water emulsions. Food Hydrocoll. 1999;13(6):459–65.

    Article  CAS  Google Scholar 

  25. Kattumuri V, Katti K, Bhaskaran S, et al. Gum arabic as a phytochemical construct for the stabilization of gold nanoparticles: in vivo pharmacokinetics and x-ray-contrast-imaging studies. Small. 2007;3(2):333–41.

    Article  CAS  PubMed  Google Scholar 

  26. Ali BH, Ziada A, Blunden G. Biological effects of gum arabic: a review of some recent research. Food Chem Toxicol. 2009;47(1):1–8.

    Article  CAS  PubMed  Google Scholar 

  27. Sharkawy A, Barreiro MF, Rodrigues AE. Preparation of chitosan/gum arabic nanoparticles and their use as novel stabilizers in oil/water Pickering emulsions. Carbohydr Polym. 2019;224:115190.

    Article  PubMed  Google Scholar 

  28. Nagendrababu V, Murray PE, Ordinola-Zapata R, Peters OA, Rôças IN, Siqueira JF, et al. PRILE 2021 guidelines for reporting laboratory studies in endodontology: a consensus-based development. Int Endod J. 2021;54:1482–90.

    Article  PubMed  Google Scholar 

  29. Salah N, Habib SS, Khan ZH, et al. High-energy ball milling technique for ZnO nanoparticles as antibacterial material. Int J Nanomedicine. 2011;6:863–9.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  30. Yusof NAA, Zain NM, Pauzi N. Synthesis of ZnO nanoparticles with chitosan as stabilizing agent and their antibacterial properties against Gram-positive and Gram-negative bacteria. Int J Biol Macromol. 2019;124:1132–6.

    Article  CAS  PubMed  Google Scholar 

  31. Leiva A, Bonardd S, Pino M, Saldías C, Kortaberria G, Radić D. Improving the performance of chitosan in the synthesis and stabilization of gold nanoparticles. Eur Polym J. 2015;68:419–31.

    Article  CAS  Google Scholar 

  32. Rossi AL, Moldovan S, Querido W, et al. Effect of strontium ranelate on bone mineral: analysis of nanoscale compositional changes. Micron. 2014;56:29–36.

    Article  CAS  PubMed  Google Scholar 

  33. Faul F, Erdfelder E, Lang AG, Buchner A. G*Power 3: a flexible statistical power analysis program for the social, behavioral, and biomedical sciences. Behav Res Methods. 2007;39(2):175–91.

    Article  PubMed  Google Scholar 

  34. Vertucci F, Seelig A, Gillis R. Root canal morphology of the human maxillary second premolar. Oral Surg Oral Med Oral Pathol. 1974;38(3):456–64.

    Article  CAS  PubMed  Google Scholar 

  35. Freeman D, Falkiner F, Keane C. New method for detecting slime production by coagulase negative staphylococci. J Clin Pathol. 1989;42(8):872–4.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. Shaaban S, Genena S, Elraggal A, Hamad GM, Meheissen MA, Moussa S. Antibacterial effectiveness of multi-strain probiotics supernatants intracanal medication on Enterococcus faecalis biofilm in a tooth model. BMC Oral Health. 2023;23(1):228.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  37. Ramos Yacasi G, García López M, Espina García M, Parra Coca A, Calpena Campmany A. Influence of freeze-drying and γ-irradiation in preclinical studies of flurbiprofen polymeric nanoparticles for ocular delivery using d- (+)-trehalose and polyethylene glycol. Int J Nanomedicine. 2016;11:4093–106.

    Article  PubMed  PubMed Central  Google Scholar 

  38. Lima RK, Guerreiro-Tanomaru JM, Faria-Júnior NB, Tanomaru-Filho M. Effectiveness of calcium hydroxide-based intracanal medicaments against Enterococcus faecalis. Int Endod J. 2012;45(4):311–6.

    Article  CAS  PubMed  Google Scholar 

  39. Afkhami F, Ahmadi P, Chiniforush N, Sooratgar A. Effect of different activations of silver nanoparticle irrigants on the elimination of Enterococcus faecalis. Clin Oral Invest. 2021;25:6893–9.

    Article  Google Scholar 

  40. Zoletti GO, Siqueira JF Jr, Santos KR. Identification of Enterococcus faecalis in root-filled teeth with or without periradicular lesions by culture-dependent and-independent approaches. J Endod. 2006;32(8):722–6.

    Article  CAS  PubMed  Google Scholar 

  41. Gabrielli ES, Lima AR, Francisco PA, et al. Comparative analysis of bacterial content, levels of lipopolysaccharides and lipoteichoic acid in symptomatic and asymptomatic endodontic infections at different stages of endodontic treatment. Clin Oral Investig. 2022;26(1):287–302.

    Article  PubMed  Google Scholar 

  42. Fahim MM, Saber SEM, Elkhatib WF, Nagy MM, Schafer E. The antibacterial effect and the incidence of post-operative pain after the application of nano-based intracanal medications during endodontic retreatment: a randomized controlled clinical trial. Clin Oral Investig. 2022;26(2):2155–63.

    Article  PubMed  Google Scholar 

  43. Javidi M, Afkhami F, Zarei M, Ghazvini K, Rajabi O. Efficacy of a combined nanoparticulate/calcium hydroxide root canal medication on elimination of Enterococcus faecalis. Aust Endod J. 2014;40(2):61–5.

    Article  PubMed  Google Scholar 

  44. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25(4):402–8.

    Article  CAS  PubMed  Google Scholar 

  45. Siqueira JF Jr, Lopes HP. Mechanisms of antimicrobial activity of calcium hydroxide: a critical review. Int Endod J. 1999;32(5):361–9.

    Article  PubMed  Google Scholar 

  46. Evans M, Davies JK, Sundqvist G, Figdor D. Mechanisms involved in the resistance of Enterococcus faecalis to calcium hydroxide. Int Endod J. 2002;35(3):221–8.

    Article  CAS  PubMed  Google Scholar 

  47. Mohammadi Z, Shalavi S, Yazdizadeh M. Antimicrobial activity of calcium hydroxide in endodontics: a review. Chonnam Med J. 2012;48(3):133–40.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  48. Momenijavid M, Salimizand H, Korani A, et al. Effect of calcium hydroxide on morphology and physicochemical properties of Enterococcus faecalis biofilm. Sci Rep. 2022;12(1):7595.

    Article  ADS  CAS  PubMed  PubMed Central  Google Scholar 

  49. Allaker RP, Memarzadeh K. Nanoparticles and the control of oral infections. Int J Antimicrob Agents. 2014;43(2):95–104.

    Article  CAS  PubMed  Google Scholar 

  50. Wu D, Fan W, Kishen A, Gutmann JL, Fan B. Evaluation of the antibacterial efficacy of silver nanoparticles against Enterococcus faecalis biofilm. J Endod. 2014;40(2):285–90.

    Article  PubMed  Google Scholar 

  51. Saber Sel D, El-Hady SA. Development of an intracanal mature Enterococcus faecalis biofilm and its susceptibility to some antimicrobial intracanal medications; an in vitro study. Eur J Dent. 2012;6(1):43–50.

    Article  Google Scholar 

  52. Singh R, Lillard JW Jr. Nanoparticle-based targeted drug delivery. Exp Mol Pathol. 2009;86(3):215–23.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  53. Roig-Soriano X, Souto EB, Elmsmari F, et al. Nanoparticles in endodontics disinfection: state of the art. Pharmaceutics. 2022;14(7):1519. Published 2022 Jul 21.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  54. Islam A, Phillips G, Sljivo A, Snowden M, Williams P. A review of recent developments on the regulatory, structural and functional aspects of gum arabic. Food Hydrocoll J. 1997;11:493–505.

    Article  CAS  Google Scholar 

  55. Nagarathinama S, Sujathaa V, Madhumathic K, et al. Effect of triple antibiotic loaded apatitic nanocarriers on Enterococcus faecalis biofilm – an in vitro study. J Drug Deliv Sci Technol. 2019;51:499–505.

    Article  Google Scholar 

  56. Alghamdi F, Shakir M. The influence of Enterococcus faecalis as a dental root canal pathogen on endodontic treatment: a systematic review. Cureus. 2020;12(3):e7257.

    PubMed  PubMed Central  Google Scholar 

  57. Meire MA, van der Waal SV. A critical analysis of research methods and experimental models to study intracanal medicaments. Int Endod J. 2022;55(Suppl 2):330–45.

    Article  PubMed  Google Scholar 

  58. Arias MP, Maliza AG, Midena RZ, Graeff MS, Duarte MA, Andrade FB. Effect of ultrasonic streaming on intra-dentinal disinfection and penetration of calcium hydroxide paste in endodontic treatment. J Appl Oral Sci. 2016;24(6):575–81.

    Article  PubMed  PubMed Central  Google Scholar 

  59. Lo Giudice G, Cutroneo G, Centofanti A, et al. Dentin morphology of root canal surface: a quantitative evaluation based on a scanning electronic microscopy study. Biomed Res Int. 2015;2015:164065.

    Article  PubMed  PubMed Central  Google Scholar 

  60. Mjör IA, Smith MR, Ferrari M, Mannocci F. The structure of dentine in the apical region of human teeth. Int Endod J. 2001;34(5):346–53.

    Article  PubMed  Google Scholar 

  61. Siqueira JF Jr. Endodontic infections: concepts, paradigms, and perspectives. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2002;94(3):281–93.

    Article  PubMed  Google Scholar 

  62. Niazi SA, Clark D, Do T, et al. The effectiveness of enzymic irrigation in removing a nutrient-stressed endodontic multispecies biofilm. Int Endod J. 2014;47(8):756–68.

    Article  CAS  PubMed  Google Scholar 

  63. Kishen A, Haapasalo M. Biofilm models and methods of biofilm assessment. Endod Top. 2012;22(1):58–78.

    Article  Google Scholar 

  64. Nallapareddy SR, Weinstock GM, Murray BE. Clinical isolates of Enterococcus faecium exhibit strain-specific collagen binding mediated by Acm, a new member of the MSCRAMM family. Mol Microbiol. 2003;47(6):1733–47.

    Article  CAS  PubMed  Google Scholar 

  65. Fisher K, Phillips C. The ecology, epidemiology and virulence of Enterococcus. Microbiol (Reading). 2009;155(Pt 6):1749–57.

    Article  CAS  Google Scholar 

  66. Ferguson DM, Talavera GN, Hernández LA, Weisberg SB, Ambrose RF, Jay JA. Virulence genes among enterococcus faecalis and Enterococcus faecium isolated from coastal beaches and human and nonhuman sources in Southern California and Puerto Rico. J Pathog. 2016;2016:3437214.

    Article  PubMed  PubMed Central  Google Scholar 

  67. Creti R, Imperi M, Bertuccini L, et al. Survey for virulence determinants among Enterococcus faecalis isolated from different sources. J Med Microbiol. 2004;53(Pt 1):13–20.

    Article  CAS  PubMed  Google Scholar 

  68. Sedgley CM, Molander A, Flannagan SE, et al. Virulence, phenotype and genotype characteristics of endodontic Enterococcus spp. Oral Microbiol Immunol. 2005;20(1):10–9.

    Article  CAS  PubMed  Google Scholar 

  69. Stuart CH, Schwartz SA, Beeson TJ, Owatz CB. Enterococcus faecalis: its role in root canal treatment failure and current concepts in retreatment. J Endod. 2006;32(2):93–8.

    Article  PubMed  Google Scholar 

  70. Zandi H, Rodrigues RC, Kristoffersen AK, et al. Antibacterial effectiveness of 2 Root Canal irrigants in Root-filled teeth with infection: a Randomized Clinical Trial. J Endod. 2016;42(9):1307–13.

    Article  PubMed  Google Scholar 

  71. Podbielski A, Spahr A, Haller B. Additive antimicrobial activity of calcium hydroxide and chlorhexidine on common endodontic bacterial pathogens. J Endod. 2003;29(5):340–5.

    Article  PubMed  Google Scholar 

  72. Blanscet ML, Tordik PA, Goodell GG. An agar diffusion comparison of the antimicrobial effect of calcium hydroxide at five different concentrations with three different vehicles. J Endod. 2008;34(10):1246–8.

    Article  PubMed  Google Scholar 

  73. Mehrvarzfar P, Akhavan H, Rastgarian H, Mohammadzade Akhlagi N, Soleymanpour R, Ahmadi A. An in vitro comparative study on the antimicrobial effects of bioglass 45S5 vs. calcium hydroxide on Enterococcus Faecalis. Iran Endod J. 2011;6(1):29–33.

    PubMed  PubMed Central  Google Scholar 

  74. Adl A, Shojaee NS, Motamedifar M. A comparison between the antimicrobial effects of triple antibiotic paste and calcium hydroxide against Entrococcus faecalis. Iran Endod J. 2012;7(3):149–55.

    PubMed  PubMed Central  Google Scholar 

  75. Mahfouz Omer SM, Mohamed DA, Ali Abdel Latif RM. Comparative evaluation of the antibacterial effect of Allium sativum, calcium hydroxide and their combination as intracanal medicaments in infected mature anterior teeth: a randomized clinical trial. Int Endod J. 2022;55(10):1010–25.

    Article  PubMed  Google Scholar 

  76. Bystrom A, Claesson R, Sundqvist G. The antibacterial effect of camphorated paramonochlorophenol, camphorated phenol and calcium hydroxide in the treatment of infected root canals. Endod Dent Traumatol. 1985;1(5):170–5.

    Article  CAS  PubMed  Google Scholar 

  77. 77 Bnuyan I, Hindi N, Mayshadijebur, Mahdi M. In vitro antimicrobial activity of gum arabic (Al manna and tayebat) prebiotics against infectious pathogens. Hum J. 2015;3(3):77–85.

    CAS  Google Scholar 

  78. Baien S, Seele J, Henneck T, et al. Antimicrobial and immunomodulatory effect of gum arabic on human and bovine granulocytes against Staphylococcus aureus and Escherichia coli. Front Immunol. 2020;10(1):1664–3224.

    Google Scholar 

  79. Saini M, Saini R, Roy S, Kumar A. Comparative pharmacognostical and antimicrobial studies of Acacia species (Mimosaceae). J Med Plants Res. 2008;2(12):378–86.

    Google Scholar 

  80. Solomon-wisdom G, Shittu G. In vitro antimicrobial and phytochemical activities of Acacia nilotica leaf extract. J Med Plant Res. 2010;4(12):1232–4.

    Google Scholar 

  81. Chaubal R, Tambe A, Biswas S, Rojatkar S, Deshpande V, Deshpande N. Isolation of new straight chain compound from Acacia nilotica. ChemInform. 2006;37(39):1231–3.

    Article  Google Scholar 

  82. Gatoo MA, Naseem S, Arfat MY, Dar AM, Qasim K, Zubair S. Physicochemical properties of nanomaterials: implication in associated toxic manifestations. Biomed Res Int. 2014;2014:498420.

    Article  PubMed  PubMed Central  Google Scholar 

  83. Aguiar AS, Guerreiro-Tanomaru JM, Faria G, Leonardo RT, Tanomaru-Filho M. Antimicrobial activity and pH of calcium hydroxide and zinc oxide nanoparticles intracanal medication and association with chlorhexidine. J Contemp Dent Pract. 2015;16(8):624–9.

    Article  PubMed  Google Scholar 

  84. Riaz Z, Raza M, Hanif A, Haider B, Akram S, Safdar S. Antibacterial efficacy of silver nanoparticles impregnated calcium hydroxide: an in vitro study. J Pak Dent Assoc. 2022;31(1):1–4.

    Article  Google Scholar 

  85. Arafa M, Mousa H, Afifi N. Preparation of PLGA-chitosan based nanocarriers for enhancing antibacterial effect of ciprofloxacin in root canal infection. Drug Deliv. 2020;27(1):26–39.

    Article  CAS  PubMed  Google Scholar 

  86. Ong TH, Chitra E, Ramamurthy S et al. Chitosan-propolis nanoparticle formulation demonstrates anti-bacterial activity against Enterococcus faecalis biofilms [published correction appears in PLoS One. 2017;12 (4):e0176629]. PLoS One. 2017;12(3):e0174888.

  87. Lenzi TL, Guglielmi Cde A, Arana-Chavez VE, Raggio DP. Tubule density and diameter in coronal dentin from primary and permanent human teeth. Microsc Microanal. 2013;19(6):1445–9.

    Article  ADS  CAS  PubMed  Google Scholar 

Download references

Acknowledgements

Not applicable.

Funding

Not applicable (Nil).

Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB).

Author information

Authors and Affiliations

  1. Department of Endodontics, Faculty of Dentistry, Suez Canal University, 4.5 Ring Road, Ismailia, 41522, Egypt

    Alshafey Alsayed Mohamed, Dalia Mukhtar Fayyad & Dalia Abd-Allah Mohamed

  2. Microbiology and Botany Department, Faculty of Science, Zagazig University, Zagazig, 44519, Egypt

    Mohamed El-Telbany

  3. Department of Bioscience and Biotechnology, Graduate School of Bioresource and Bioenvironmental Sciences, Kyushu University, 744 Motooka, Nishi-Ku, Fukuoka, 819-0395, Japan

    Mohamed El-Telbany

  4. Department of Endodontics, Faculty of Dentistry, Sinai University, Kantara, Ismailia, Egypt

    Dalia Abd-Allah Mohamed

Authors
  1. Alshafey Alsayed Mohamed
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Dalia Mukhtar Fayyad
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Mohamed El-Telbany
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Dalia Abd-Allah Mohamed
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

All authors contributed to this research: Assoc. Prof. DAM & DR. AAM: Research designing, experimental study, collecting & analysis of the data, and writing of the scientific manuscript. ME: Research designing, microbiology lab work, collecting of the data, and writing of the scientific manuscript. Prof. DMF: Research designing, analysis of the data writing, and reviewing of the scientific manuscript. All authors reviwed and approved the final manuscript.

Corresponding author

Correspondence to Dalia Abd-Allah Mohamed.

Ethics declarations

Ethics approval and consent to participate

This study was approved by the Institutional Research Ethics Committee (REC), Faculty of Dentistry, Suez Canal University, Egypt. Protocol No: 347/2021. We hereby verify that all procedures agree with the relevant recommendations and regulations.

Consent for publication

Not applicable according to the ethical committee at the Faculty of Dentistry, Suez Canal University, Egypt.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

12903_2024_3941_MOESM1_ESM.jpg

Supplementary Material 1: Figure S1. The PRILE flowchart [28] for the current study

12903_2024_3941_MOESM2_ESM.jpg

Supplementary Material 2: Figure S2. Photomicrograph showing A: growth of E. faecalis on CRA caused blacking of the medium due to EPS production referring to biofilm formation and (B) no change in color in the control sample

12903_2024_3941_MOESM3_ESM.jpg

Supplementary Material 3: Figure S3. Representative image for Q-PCR melting curve showing CT of E. faecalis bacteria in response to different tested intracanal medications; (c) representing control group, (1) representing Ca (OH)2, (2) representing nano Ca (OH)2, (3) representing GA, (4) representing nano GA, (5) representing Ca (OH)2 loaded on nano GA

Supplementary Material 4

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Mohamed, A.A., Fayyad, D.M., El-Telbany, M. et al. Antibacterial biofilm efficacy of calcium hydroxide loaded on Gum Arabic nanocarrier: an in-vitro study. BMC Oral Health 24, 215 (2024). https://doi.org/10.1186/s12903-024-03941-3

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12903-024-03941-3

Keywords

BMC Oral Health

ISSN: 1472-6831

Contact us